Overview

Comprehensive Description

Biology

Prefers hard bottom, rocks, jetties and ledges.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: North Carolina to Palm Beach in Florida and northern Gulf of Mexico in the USA
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: North Carolina to Palm Beach in Florida and northern Gulf of Mexico in the USA.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 7251))
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 518 specimens in 1 taxon.
Water temperature and chemistry ranges based on 123 samples.

Environmental ranges
  Depth range (m): 0 - 243
  Temperature range (°C): 9.264 - 25.874
  Nitrate (umol/L): 0.289 - 18.243
  Salinity (PPS): 33.239 - 36.378
  Oxygen (ml/l): 3.686 - 6.300
  Phosphate (umol/l): 0.092 - 1.156
  Silicate (umol/l): 0.756 - 11.020

Graphical representation

Depth range (m): 0 - 243

Temperature range (°C): 9.264 - 25.874

Nitrate (umol/L): 0.289 - 18.243

Salinity (PPS): 33.239 - 36.378

Oxygen (ml/l): 3.686 - 6.300

Phosphate (umol/l): 0.092 - 1.156

Silicate (umol/l): 0.756 - 11.020
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centropristis philadelphica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTTGGCGCCTGAGCCGGAATGGTGGGCACCGCCCTGAGCCTTCTAATTCGGGCTGAACTAAGCCAGCCGGGGGCCCTGCTAGGGGACGACCAAATTTACAATGTAATCGTCACGGCGCATGCCTTCGTAATAATTTTTTTTATAGTAATGCCTATCATAATTGGGGGCTTCGGCAACTGATTAATCCCCCTAATAATTGGAGCCCCAGACATAGCCTTTCCTCGCATAAACAACATAAGCTTCTGACTCCTACCCCCATCTTTCATTTTATTACTGGCCTCCTCCGGTGTAGAGGCCGGTGCAGGCACCGGATGAACAGTATACCCCCCTCTTGCCGGCAACCTAGCGCACGCAGGAGCATCAGTTGACCTGACAATTTTCTCCCTCCACCTAGCTGGGATCTCATCAATCCTGGGGGCTATCAACTTTATTACAACAATTATTAATATAAAACCCCCTGCCATTTCTCAGTACCAAACACCTTTATTTGTATGAGCTGTTCTAATTACGGCAGTCCTGCTGCTCCTGTCCCTACCAGTCCTTGCTGCAGGGATCACGATACTATTAACTGACCGAAACTTAAACACTACATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Centropristis philadelphica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!