Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

The Ostracion meleagris, also known as the Spotted Boxfish, lives in the waters of the Indo-Pacific region and usually inhabits clear lagoons and seaward reefs.2 It has brilliant coloration as a result of sexual dimorphism and can be up to six inches in length.1

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: boxfish (English), pez-caja (Espanol), pez-cofre (Espanol), cofre (Espanol)
 
Ostracion meleagris meleagris Shaw in Shaw & Nodder, 1796


Spotted boxfish,     White spotted boxfish



Body oblong, thick, enclosed in a bony box formed by thickened, joined, enlarged, hexagonal scale plates; box rectangular, with back gently rounded, a pair of rounded longitudinal ridges on lower flanks, bottom flat; box without spines, with openings for mouth, eyes, gill slits and fins and tail base; snout not projecting; mouth small, opens at front, lips fleshy; teeth moderate, conical, usually < 15 per jaw; gill openings are short, oblique slits in front of pectoral bases; no spiny dorsal, soft dorsal and anal fins at rear of carapace; dorsal rays 9; anal rays 9; pectoral rays 11; no pelvic fins; tail base slender, flexible; tail fin 8 branched rays, a fan rounded in females, straight with rounded corners in males; lateral line inconspicuous.


Juveniles and females  dark brown with small brown white spots; males  dark brown with small white spots dorsally on carapace, blue elsewhere with dark-edged orange-yellow spots on side, these sometimes coalescing along upper flank ridge to form an irregular band. 


Size: grows to 25 cm.

Inhabits coral and rocky reefs.

Depth: 3-30 m.

Wide ranging in the tropical Indo-Pacific from East Africa to the Americas; the tip of Baja, the SE Gulf of California to Ecuador and all the oceanic islands.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits clear lagoon and seaward reefs from the lower surge zone to at least 30 meters (Ref. 37816, 48637). Juveniles among rocky boulders, often with long spined urchins, and adults on reef crests and slopes. Males swim about more openly than females that are often in close vicinity to the males (Ref. 48637). Solitary. Feeds on didemnid tunicates, polychaetes, sponges, mollusks, copepods, and algae (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The scales of the Ostracion meleagris is what makes it unique.3 On a conventional scaled fish, the scales are overlapping.3 However, in the Ostracion meleagris, the scales form "hexagonal bony plates that are fused together to form a rigid body case," which makes them have a bell shaped and inflexible body.3 Their bony carapace encloses them so that only the eyes, jaws, and fins are mobile, and they also have extensive vertebral fusion.1

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Juvenilles and females usually have brown, green, or white spots, while large males have orange bands or spots on the sides of their body.2 This species of fish usually has caudal fin rays, or a tail fin, and is sexually dimorphic.2

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Depth

Depth Range (m): 3 (S) - 30 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific and Eastern Pacific: East Africa to the Mexico, north to southern Japan and the Hawaiian Islands, south to New Caledonia and the Tuamoto Islands. The subspecies Ostracion meleagris camurum is found in the Hawaiian Islands and Ostracion meleagris clippertonense in the Eastern Pacific. Species replaced by Ostracion cyanurus in Red Sea and Gulf of Aden.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific, Hawaii, Polynesia, Pacific Coast of Mexico to Panama, Africa. 2

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Hawaiian Islands, north to southern Japan and Ogasawara Islands, south to Great Barrier Reef (Australia), New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Gulf of California (Mexico) south to Colombia, including offshore islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 25.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 9; Analspines: 0; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Ostracion meleagris is sexually dimorphic, meaning that there is a difference between members of opposite sexes in the same species. In the case of fish, the female is usually larger than the male. Males are also more colorful than females and have a "vibrant blue body and a black swatch covering the body."7 The entire body of a male boxfish is also covered with white and black dots.7 Females are only black and speckled with white dots.7

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 3141))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

4-6 inches (10-15 cm.)2

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits clear lagoon and seaward reefs from the lower surge zone to at least 30 m. Feeds on didemnid tunicates, polychaetes, sponges, molluscs, copepods, and algae.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Juveniles and females brown or green with white spots; large males with orange bands and spots on side of body (Ref. 3141). Caudal fin rays 10 (Ref. 3141). Sexually dimorphic (Ref. 37816).Description: Characterized further by having quadrangular carapace in cross section, absence of conspicuous bulge; more or less straight dorsal profile of snout, lacking bony protuberance above upper lip; rounded caudal fin (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Ostracion meleagris
Catalog Number: USNM 50668
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ostracion meleagris
Catalog Number: USNM 49697
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): O. Jenkins
Locality: Hawaiian Islands., Hawaii, United States, Hawaiian Islands, Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 67 specimens in 2 taxa.
Water temperature and chemistry ranges based on 55 samples.

Environmental ranges
  Depth range (m): 0.61 - 497
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.006 - 5.562
  Salinity (PPS): 32.200 - 35.924
  Oxygen (ml/l): 4.243 - 5.079
  Phosphate (umol/l): 0.085 - 0.628
  Silicate (umol/l): 0.803 - 4.465

Graphical representation

Depth range (m): 0.61 - 497

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.006 - 5.562

Salinity (PPS): 32.200 - 35.924

Oxygen (ml/l): 4.243 - 5.079

Phosphate (umol/l): 0.085 - 0.628

Silicate (umol/l): 0.803 - 4.465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Ostracion meleagris lives in the clear lagoons and the seaward reefs of the Indo-Pacific waters. It lives at a depth of about thirty meters.2

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated. Inhabits clear lagoon and seaward reefs from the lower surge zone to at least 30 m. Feeds on didemnid tunicates, polychaetes, sponges, molluscs, copepods, and algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: benthic microalgae, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sponges/seasquirts/bryozoa, sessile worms
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits clear lagoon and seaward reefs from the lower surge zone to at least 30 meters (Ref. 37816, 48637). Juveniles among rocky boulders, often with long spined urchins, and adults on reef crests and slopes. Males swim about more openly than females that are often in close vicinity to the males (Ref. 48637). Solitary. Feeds on didemnid tunicates, polychaetes, sponges, mollusks, copepods, and algae (Ref. 37816). Sessile-invertebrate feeder (Ref. 57615). Also Ref. 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ostracion meleagris are omnivores that forage in small groups.1 Their diet consists of didemnid tunicates, polychaetes, sponges, mollusks, copepods, and algae.2

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The Ostracion meleagris uses ostraciiform swimming, a method that is named after this species.1 It is a type of tetraodontiform fish, which means that it "hovers...using [its] highly modified fins" as a way of movement.1 It swims by moving its flexible caudal fin, which allows propulsion through the water.1 The caudal fin swings side to side, and this fish is usually slow at swimming because of its lack of flexibility.1 The fish also releases a mucus onto its body to prevent predators from attacking it.3 Females also have a long snout that allows them to "blow jets of water into the sediment" to find small invertebrates to eat, an adaptation that has developed after millions of years.4 Spotted Boxfish live in small haremic groups with one male and several females and also forage for food in these groups.6

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males usually have a "harem" that encompasses many females.6 The males initiate courtship by "circling and nudging...the females."6 The female and the male then swim side by side with their tails touching and heads slightly apart.6 At this point, they release their gametes by making a low-pitched spawning sound.6 The male then swims off to find another female to mate with.6 Males also use this spawning sound in aggressive contexts, when many males actively compete to mate with certain females.8 This sound can definitely be heard underwater by the human ear and quietly above ground.8

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Fish maintain stability in turbulence: spotted boxfish
 

Keels of boxfish provide stability in turbulent water by generating strong, longitudinal vortices.

     
  "The marine boxfishes (Teleostei: Ostraciidae) are mostly shallow-water, tropical reef-dwelling fishes that have 2/3–3/4 of their bodies encased in rigid bony carapaces, which are keeled with various protuberances (Tyler, 1980; Nelson, 1994). As a result, many boxfishes cannot bend their bodies anterior to their caudal peduncles, and almost all of their swimming movements
derive from complex combinations of motions of their five fins. Field observations and recent studies on the swimming physiology of boxfishes indicate that they are capable of remarkably low recoil motions, resulting in smooth, energy-efficient swimming trajectories that do not compromise maneuverability...Hove et al. (2001) found that boxfishes exhibit some of the smallest amplitude recoil moments known among fishes. As a result they swim in smoother trajectories than either body and caudal fin (BCF) or single- complex median and paired fin (MPF) swimmers. Results from our study
[study looked at four species: spotted boxfish Ostracion meleagris, smooth trunkfish Lactophrys triqueter, scrawled cowfish Acanthostracion quadricornis, and buffalo trunkfish Lactophrys trigonus] indicate that the keeled bony carapace plays an important role in producing this longitudinal stability. Control for pitching is important for fishes, such as boxfishes, that live in highly energetic waters with frequent external disturbances like turbulence. In these environments, effective compensation for perturbations, which can lead to significant displacements and energy-wasting erratic trajectories, is essential for effective and economical swimming (Weihs, 1993; Webb, 2000). Maintenance of smooth swimming trajectories also presumably improves sensory acuity of both hostile and target objects because it reduces complexity of movement, a factor that improves sensory perception in other animals (Land, 1999; Kramer and McLaughlin, 2001)." (Bartol et al. 2002:971, 979)
  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ostracion meleagris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTATTTAGTATTTGGTGCTTGAGCCGGTATAGTAGGGACGGCCCTAAGCCTACTTATCCGAGCAGAACTAAGCCAGCCAGGCGCTCTTCTTGGGGATGATCAGATTTATAATGTAATCGTAACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGCTTTGGAAACTGATTAGTACCTCTAATAATTGGAGCCCCTGATATAGCATTTCCCCGAATGAACAACATAAGCTTCTGGCTCCTTCCTCCTTCATTCCTACTCCTCCTGGCCTCTTCAGGAGTTGAAGCAGGTGCTGGAACTGGGTGAACAGTTTATCCTCCCTTAGCAGGTAACCTGGCACATGCAGGGGCATCTGTTGATCTAACCATCTTTTCCCTCCATCTGGCAGGAGTTTCCTCAATTTTAGGGGCTATTAATTTTATCACCACAATTATTAATATGAAACCCCCAGCTATCTCCCAATATCAAACCCCTCTATTTGTGTGGGCAGTTCTGATTACCGCTGTTCTCCTCCTTCTATCACTACCAGTTCTTGCTGCTGGTATCACAATACTTCTAACAGACCGAAACCTAAACACCACATTCTTTGACCCAGCAGGAGGCGGGGACCCAATCCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ostracion meleagris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 52
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No conservation concerns, but it hasn't been evaluated by the IUCN.

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Humans use the Ostracion meleagris for commercial purposes, and many are kept in aquariums for the general public to see. They must be kept in at least a 50 gallon tank.7

Public Domain

Yinga Xia

Source: eNemo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ostracion meleagris

Ostracion meleagris, the White-spotted boxfish, is a species of boxfish found in the Indian and Pacific Oceans. It is found on reefs at depths of from 1 to 30 metres (3.3 to 98.4 ft). This species grows to a length of 25 centimetres (9.8 in) TL. Males and females differ in colour: males are blackish on the back with white spots, and have bluish sides with bright yellowish bands and spots. Females and juveniles are dark brown to blackish with white spots.[1]

References[edit]

  1. ^ Dianne J. Bray, 2011, Black Boxfish, Ostracion meleagris, in Fishes of Australia, accessed 07 Oct 2014, http://www.fishesofaustralia.net.au/home/species/2475


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!