Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occur in clear waters and coral-rich areas of lagoon and seaward reefs. However, only common in seaward reefs (Ref. 1602). Benthopelagic (Ref. 58302). Juveniles are solitary, living among branching corals, while adults are almost always in pairs and are home-ranging. Feed exclusively on coral tissue (Ref. 1602). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the Indo-west Pacific from the Seychelles and Maldives to the Pitcairn group north to southern Japan and the Hawaiian Islands, and south to Lord Howe and Rapa Iti Islands. Records from the western and central Indian Ocean from the Seychelles and Maldives are likely based on vagrants (R. Myers pers. comm. 2009). This species is found at depths of 1-36 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Sri Lanka to the Hawaiian, Marquesan and Ducie islands, north to southern Japan, south to Lord Howe and Rapa Islands; throughout Micronesia.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Sri Lanka east to Hawaiian Islands, northern Line Islands and Pitcairn Group, north to southern Japan, south to Western Australia, New South Wales (Australia), Lord Howe Island, New Caledonia, Tonga, Rapa and Gambier Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 24 - 28; Analspines: 3; Analsoft rays: 20 - 23
  • Burgess, W.E. 1978 Butterflyfishes of the world. A monograph of the Family Chaetodontidae. T.F.H. Publications, Neptune City, New Jersey. (Ref. 4855)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body is white with orange to orange-brown oblique bands on the sides. Two broad yellow-edged black bars are on the head; one running across the eye and another on the snout (Ref. 4855). Snout length 2.6-3.2 in HL. Body depth 1.3-1.6 in SL (Ref. 90102).
  • Burgess, W.E. 1978 Butterflyfishes of the world. A monograph of the Family Chaetodontidae. T.F.H. Publications, Neptune City, New Jersey. (Ref. 4855)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in coral-rich areas, in lagoons and on outer reefs. Depth range is from 1-36 m. Feeds exclusively on coral polyps and exhibits home-ranging behaviour. Juveniles occur singly among the branches of hard corals (G.R. Allen pers. comm. 2006). This species is unique among coral-feeding butterflyfishes as it tends to feed on mucous rather than coral tissue (Cole et al. 2008).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 36 m (Ref. 1602)
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 43 samples.

Environmental ranges
  Depth range (m): 1 - 53
  Temperature range (°C): 22.496 - 29.214
  Nitrate (umol/L): 0.053 - 1.522
  Salinity (PPS): 34.131 - 36.142
  Oxygen (ml/l): 4.406 - 5.079
  Phosphate (umol/l): 0.092 - 0.301
  Silicate (umol/l): 1.072 - 4.599

Graphical representation

Depth range (m): 1 - 53

Temperature range (°C): 22.496 - 29.214

Nitrate (umol/L): 0.053 - 1.522

Salinity (PPS): 34.131 - 36.142

Oxygen (ml/l): 4.406 - 5.079

Phosphate (umol/l): 0.092 - 0.301

Silicate (umol/l): 1.072 - 4.599
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 36m.
From 1 to 36 meters.

Habitat: reef-associated. Occurs in clear waters and coral-rich areas of lagoon and seaward reefs. However, it is only common in seaward reefs. Juveniles are solitary, living among branching corals, while adults are almost always in pairs and are home-ranging. Feeds exclusively on coral tissue.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in clear waters and coral-rich areas of lagoon and seaward reefs. However, it is only common in seaward reefs. Juveniles are solitary, living among branching corals, while adults are almost always in pairs and are home-ranging. Feeds exclusively on coral tissue (Ref. 1602). A blunt-snouted species, which scrapes away mucus that the polyps have produced that has concentrated over abrasions on the coral surface (Ref. 59308).
  • Steene, R.C. 1978 Butterfly and angelfishes of the world. A.H. & A.W. Reed Pty Ltd., Australia. vol. 1. 144 p. (Ref. 4859)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon ornatissimus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACCGCCTTAAGCCTGCTCATCCGAGCAGAGCTCAGCCAACCTGGCTCACTCTTAGGAGATGACCAGATCTATAATGTAATCGTCACGGCACATGCGTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGTTTTGGTAACTGACTAATTCCTTTAATGATTGGGGCCCCCGATATGGCTTTCCCTCGAATAAATAATATAAGCTTCTGACTCCTACCACCTTCCTTCTTTCTGCTTCTTGCCTCTTCTGGTGTAGAATCAGGGGCTGGGACCGGGTGGACAGTCTATCCGCCGCTAGCTGGAAACCTAGCACATGCTGGAGCATCCGTTGATTTAACAATCTTCTCCCTCCACCTTGCTGGAATCTCCTCTATCCTTGGGGCTATTAATTTTATTACAACAATCCTTAACATGAAACCTCCTGCTATGTCTCAATATCAAACCCCGCTCTTCGTATGATCTGTTCTAATTACAGCTGTCCTGCTTCTCCTTTCCCTCCCTGTCCTTGCAGCCGGTATTACAATACTCCTTACGGACCGAAACCTTAATACGACTTTCTTTGACCCTGCAGGAGGGGGCGACCCTATTCTGTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon ornatissimus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
Chaetodon ornatissimus feeds exclusively on live coral, making it susceptible to extensive coral loss. There have been localized declines documented due to coral loss, however, it has a wide distribution, apparently large population and no obvious major threats other than coral loss. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

It is generally common. This species has shown a substantial decline following coral loss at Moorea (French Polynesia) in 1981, but has since recovered (Berumen and Pratchett 2006).



Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species relies on live coral for food and/or recruitment and was shown to decline following coral depletion in 1981 in a small part of its range, but has since recovered (Berumen and Pratchett 2006). There appear to be no other major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is present within marine protected areas. Monitoring of this species is needed in conjunction with coral monitoring, as well as determination of the degree of co-dependence between this species and corals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ornate butterflyfish

The Ornate Butterflyfish, Chaetodon ornatissimus, is a species of butterflyfish (family Chaetodontidae). The Ornate Butterflyfish is widespread throughout the tropical waters of the Indo-Pacific area.[1]

The Coral hind is a small size fish and can reach a maximum size of 20 cm length .[2] It is found in depths down to 36 m.[3]

It is a close relative of the Mailed Butterflyfish (C. reticulatus) and the Scrawled Butterflyfish (C. meyeri). Together they make up the subgenus called "Citharoedus", but as this name had already been used for a mollusc genus when it was given to the fish, it is not valid. They are probably quite close to the subgenus Corallochaetodon which contains for example the Melon Butterflyfish (C. trifasciatus). Like these, they might be separated in Megaprotodon if the genus Chaetodon is split up.[4]

Footnotes[edit source | edit]

  1. ^ http://eol.org/pages/212628/details#distribution
  2. ^ http://www.fishbase.org/summary/6550
  3. ^ FishBase [2008]
  4. ^ Fessler & Westneat (2007), Hsu et al. (2007)

References[edit source | edit]

  • Fessler, Jennifer L. & Westneat, Mark W. (2007): Molecular phylogenetics of the butterflyfishes (Chaetodontidae): Taxonomy and biogeography of a global coral reef fish family. Mol. Phylogenet. Evol. 45(1): 50–68. doi:10.1016/j.ympev.2007.05.018 (HTML abstract)
  • FishBase [2008]: Chaetodon ornatissimus. Retrieved 2008-SEP-01.
  • Hsu, Kui-Ching; Chen, Jeng-Ping & Shao, Kwang-Tsao (2007): Molecular phylogeny of Chaetodon (Teleostei: Chaetodontidae) in the Indo-West Pacific: evolution in geminate species pairs and species groups. Raffles Bulletin of Zoology Supplement 14: 77-86. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!