Overview

Comprehensive Description

Biology

Adults occur in lagoon and outer reefs in pairs and small groups (Ref. 48636). Monogamous (Ref. 55367). A protandrous hermaphrodite (Ref. 32166). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemones: Heteractis crispa and Stichodactyla mertensii (Ref. 5911). Have been reared in captivity (Ref. 35413, 35418, 35420).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: Christmas Island and Western Australia to the Ryukyu Islands, Taiwan, Philippines, New Guinea, D'Entrecasteaux Islands, New Britain, and Solomon Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Amphiprion sandaracinos is distributed from Christmas Island and Western Australia to Papua New Guinea, Indonesia, Melanesia, the Philippines, Palau and northwards to the Ryukyu Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 6 - 18; Analspines: 2; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 140 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinguished by the thick white line running from the snout over the back (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Amphiprion sandaracinos
Catalog Number: USNM 160663
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Marinduque Island and Vicinity; Capulaan Bay, Pagbilao Chica Island, Pagbilao Chica Island, Quezon, Philippines, Philippine Archipelago, Capulaan Bay, Pacific
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Amphiprion sandaracinos
Catalog Number: USNM 147130
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Marinduque Island and Vicinity; Capulaan Bay, Pagbilao Chica Island, Pagbilao Chica Island, Quezon, Philippines, Philippine Archipelago, Capulaan Bay, Pacific
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Amphiprion sandaracinos
Catalog Number: USNM 160664
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Bolinao Bay (East of Village); West Coast of Luzon, Manila Bay To Lingayen Gulf, Luzon, Philippines, Bolinao Bay, Pacific
Depth (m): 3 to 4
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 3 - 20 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The anemonefish Amphiprion sandaracinos has a depth range of 3 - 20 m and is found in lagoons and outer coral reefs. It is most commonly associated with the host anemone species' Stichodactyla mertensii and less frequently with Heteractis crispa (Fautin and Allen 1992). This species is a protandrous hermaphrodite (G. Allen pers. comm. 2009). This species is monogamous (G. Allen pers. comm. 2009).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 21

Graphical representation

Depth range (m): 1 - 21
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 20m.
From 3 to 20 meters.

Habitat: reef-associated. Occurs in lagoon and outer reefs, commensal with the anemone @Stoichactis giganteum@, and @S. mertensii@.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in lagoon and outer reefs, commensal with the anemone Stoichactis giganteum, and S. mertensii. Has been reared in captivity (Ref. 35413, 35418, 35420, 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Benthic spawner. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Length at sex change = 5.1 cm TL (Ref. 55367). Also Ref. 240, 7471.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiprion sandaracinos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAATTTTCGGTGCTTGAGCTGGAATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTTTTAGGAGATGATCAGATTTATAACGTTATTGTTACCGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTAATTGGAGGATTTGGAAACTGACTAGTGCCCCTCATGCTTGGCGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTTCTTCTGCTTGCCTCCTCAGGGGTTGAAGCCGGGGCCGGAACAGGCTGAACTGTTTACCCACCACTGTCTGGGAACCTAGCCCATGCAGGAGCATCAGTAGACCTAACTATCTTCTCCCTCCACCTGGCAGGTGTTTCATCAATCCTGGGAGCAATCAACTTTATTACTACCATTATTAACATGAAACCCCCTGCCATCACACAGTATCAAACCCCTCTATTTGTTTGAGCTGTCCTAATTACTGCTGTTCTTCTCCTCCTCTCTCTCCCAGTTTTAGCTGCCGGTATTACTATGCTCTTAACAGACCGAAACCTAAATACTACCTTCTTTGATCCAGCAGGAGGAGGAGATCCAATTCTCTACCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amphiprion sandaracinos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Curtis-Quick, J.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. and Livingston, F.

Justification
Amphiprion sandaracinos has been assessed as Least Concern. This species is relatively common throughout its range without any appreciable decline over the last 30 - 40years. Current threats are of a localised nature only.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Amphiprion sandaracinos is relatively common throughout its range (G. Allen pers. comm. 2009). This species is commensal with sea anemones, usually one adult pair and several juveniles per anemone (G. Allen pers. comm. 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Amphiprion sandaracinos is commercially harvested for the aquarium trade, and it is caught with hand nets (FAO 2001). The anemone in which this species resides, is also commercially harvested for the aquarium trade.

In areas of its range it is threatened by habitat degradation due to eutrophication, destructive fishing practices, tourism, coral bleaching, coastal development and water pollution.

The threats detailed are mainly of a localised nature and do not pose a significant threat to the global population of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Amphiprion sandaracinos has been bred in captivity. The distribution of this species may fall within numerous marine protected areas including the Christmas Island National Park.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Orange skunk clownfish

The orange skunk clownfish, Amphiprion sandaracinos, also known as the skunk-striped anemonefish is a type of clownfish that is very bright orange, with a white stripe on the dorsal ridge from the mouth, between the eyes and ending after the dorsal fin. It grows to about 5.5 inches, and lives in the western Pacific Ocean. Amphiprion sandaracinos was recently observed to coexist with the Clark's anemonefish Amphiprion clarkii within one host anemone of Stichodactyla mertensii.[1]

In the aquarium

It is an omnivore, its diet including shrimp, and is best when supplied with an anemone. The minimum tank size for the fish is 30 gallons.

References

  1. ^ Bos, Arthur (2012). "Clownfishes Amphiprion clarkii and A. sandaracinos (Pomacentridae) coexist in the sea anemone Stichodactyla mertensii". Coral Reefs 30: 369. doi:10.1007/s00338-010-0713-3.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!