Amphiprion sandaracinos — Details

Yellow Clownfish learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Adults occur in lagoon and outer reefs in pairs and small groups (Ref. 48636). Monogamous (Ref. 55367). A protandrous hermaphrodite (Ref. 32166). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemones: Heteractis crispa and Stichodactyla mertensii (Ref. 5911). Have been reared in captivity (Ref. 35413, 35418, 35420).

Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247) http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Western Pacific: Christmas Island and Western Australia to the Ryukyu Islands, Taiwan, Philippines, New Guinea, D'Entrecasteaux Islands, New Britain, and Solomon Islands.

Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247) http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Range Description

Learn more about this article

Amphiprion sandaracinos is distributed from Christmas Island and Western Australia to Papua New Guinea, Indonesia, Melanesia, the Philippines, Palau and northwards to the Ryukyu Islands.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

West Pacific and southeastern Indian Ocean.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 9; Dorsal soft rays (total): 6 - 18; Analspines: 2; Analsoft rays: 12

Allen, G.R. 1975 Damselfishes of the South Seas. T.F.H. Publications, Inc., Neptune City, New Jersey. 240 p. (Ref. 4966) http://www.fishbase.org/references/FBRefSummary.php?id=4966&speccode=6652

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 140 mm NG

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

14.0 cm TL (male/unsexed; (Ref. 9710))

Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710) http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Distinguished by the thick white line running from the snout over the back (Ref. 48636).

Allen, G.R. 1975 Damselfishes of the South Seas. T.F.H. Publications, Inc., Neptune City, New Jersey. 240 p. (Ref. 4966) http://www.fishbase.org/references/FBRefSummary.php?id=4966&speccode=6652

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Paratype for Amphiprion sandaracinos
Catalog Number: USNM 160663
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Marinduque Island and Vicinity; Capulaan Bay, Pagbilao Chica Island, Pagbilao Chica Island, Quezon, Philippines, Philippine Archipelago, Capulaan Bay, Pacific
Vessel: Albatross

Paratype:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Amphiprion sandaracinos
Catalog Number: USNM 147130
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Marinduque Island and Vicinity; Capulaan Bay, Pagbilao Chica Island, Pagbilao Chica Island, Quezon, Philippines, Philippine Archipelago, Capulaan Bay, Pacific
Vessel: Albatross

Paratype:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Amphiprion sandaracinos
Catalog Number: USNM 160664
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: Bolinao Bay (East of Village); West Coast of Luzon, Manila Bay To Lingayen Gulf, Luzon, Philippines, Bolinao Bay, Pacific
Depth (m): 3 to 4
Vessel: Albatross

Paratype:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

reef-associated; non-migratory; marine; depth range 3 - 20 m (Ref. 7247)

Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247) http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Habitat and Ecology

Learn more about this article

Habitat and Ecology

The anemonefish Amphiprion sandaracinos has a depth range of 3 - 20 m and is found in lagoons and outer coral reefs. It is most commonly associated with the host anemone species' Stichodactyla mertensii and less frequently with Heteractis crispa (Fautin and Allen 1992). This species is a protandrous hermaphrodite (G. Allen pers. comm. 2009). This species is monogamous (G. Allen pers. comm. 2009).

Systems

Marine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 7 specimens in 1 taxon.

Environmental ranges
Depth range (m): 1 - 21

Graphical representation

Depth range (m): 1 - 21

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 3 - 20m.
From 3 to 20 meters.

Habitat: reef-associated. Occurs in lagoon and outer reefs, commensal with the anemone @Stoichactis giganteum@, and @S. mertensii@.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Occurs in lagoon and outer reefs, commensal with the anemone Stoichactis giganteum, and S. mertensii. Has been reared in captivity (Ref. 35413, 35418, 35420, 37816).

Masuda, H. and G.R. Allen 1993 Meeresfische der Welt - GroÃ-Indopazifische Region. Tetra Verlag, Herrenteich, Melle. 528 p. (Ref. 9137) http://www.fishbase.org/references/FBRefSummary.php?id=9137&speccode=127

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Benthic spawner. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Length at sex change = 5.1 cm TL (Ref. 55367). Also Ref. 240, 7471.

Moyer, J.T. and A. Nakazono 1978 Protandrous hermaphroditism in six species of the anemonefish genus Amphiprion in Japan. Jap. J. Ichthyol. 25(2):101-106. (Ref. 32166) http://www.fishbase.org/references/FBRefSummary.php?id=32166&speccode=5448

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiprion sandaracinos

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAATTTTCGGTGCTTGAGCTGGAATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTTTTAGGAGATGATCAGATTTATAACGTTATTGTTACCGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTAATTGGAGGATTTGGAAACTGACTAGTGCCCCTCATGCTTGGCGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTTCTTCTGCTTGCCTCCTCAGGGGTTGAAGCCGGGGCCGGAACAGGCTGAACTGTTTACCCACCACTGTCTGGGAACCTAGCCCATGCAGGAGCATCAGTAGACCTAACTATCTTCTCCCTCCACCTGGCAGGTGTTTCATCAATCCTGGGAGCAATCAACTTTATTACTACCATTATTAACATGAAACCCCCTGCCATCACACAGTATCAAACCCCTCTATTTGTTTGAGCTGTCCTAATTACTGCTGTTCTTCTCCTCCTCTCTCTCCCAGTTTTAGCTGCCGGTATTACTATGCTCTTAACAGACCGAAACCTAAATACTACCTTCTTTGATCCAGCAGGAGGAGGAGATCCAATTCTCTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Amphiprion sandaracinos

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article

Red List Category

LC

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2010

Assessor/s

Curtis-Quick, J.

Reviewer/s

Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s

De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. and Livingston, F.

Justification

Amphiprion sandaracinos has been assessed as Least Concern. This species is relatively common throughout its range without any appreciable decline over the last 30 - 40years. Current threats are of a localised nature only.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trends

Population

Learn more about this article

Population

Amphiprion sandaracinos is relatively common throughout its range (G. Allen pers. comm. 2009). This species is commensal with sea anemones, usually one adult pair and several juveniles per anemone (G. Allen pers. comm. 2009).

Population Trend

Stable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Least Concern (LC)

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Major Threats

Amphiprion sandaracinos is commercially harvested for the aquarium trade, and it is caught with hand nets (FAO 2001). The anemone in which this species resides, is also commercially harvested for the aquarium trade.

In areas of its range it is threatened by habitat degradation due to eutrophication, destructive fishing practices, tourism, coral bleaching, coastal development and water pollution.

The threats detailed are mainly of a localised nature and do not pose a significant threat to the global population of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions

Amphiprion sandaracinos has been bred in captivity. The distribution of this species may fall within numerous marine protected areas including the Christmas Island National Park.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

aquarium: commercial

Baensch, H.A. 1992 Neue Meerwasser-Praxis. Tetra Verlag, Melle, Germany. (Ref. 7309) http://www.fishbase.org/references/FBRefSummary.php?id=7309&speccode=944

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Orange skunk clownfish

Learn more about this article

The orange skunk clownfish, Amphiprion sandaracinos, also known as the skunk-striped anemonefish is a type of clownfish that is very bright orange, with a white stripe on the dorsal ridge from the mouth, between the eyes and ending after the dorsal fin. It grows to about 5.5 inches, and lives in the western Pacific Ocean. Amphiprion sandaracinos was recently observed to coexist with the Clark's anemonefish Amphiprion clarkii within one host anemone of Stichodactyla mertensii.^[1]

In the aquarium

It is an omnivore, its diet including shrimp, and is best when supplied with an anemone. The minimum tank size for the fish is 30 gallons.

References

^ Bos, Arthur (2012). "Clownfishes Amphiprion clarkii and A. sandaracinos (Pomacentridae) coexist in the sea anemone Stichodactyla mertensii". Coral Reefs 30: 369. doi:10.1007/s00338-010-0713-3.

"Amphiprion sandaracinos". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=615209. Retrieved 6 June 2006.
Froese, Rainer, and Daniel Pauly, eds. (2005). "Amphiprion sandaracinos" in FishBase. November 2005 version.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!