Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found in lagoon reefs and embayment. Monogamous (Ref. 52884), protandrous hermaphrodite (Ref. 55367). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemone Entacmaea quadricolor (Ref. 5911). Has been reared in captivity (Ref. 35413, 35415, 35418, 35420).
  • Fautin, D.G. and G.R. Allen 1992 Field guide to anemonefishes and their host sea anemones. Western Australian Museum, Francis Street, Perth. (Ref. 5911)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Tomato clownfish are known to be found in the Oriental Region of the Western Pacific, namely, South China Sea, Indonesia, Singapore, Malaysia, Thailand, Viet Nam, China, Philippines, and Taiwan. They have been found to inhabit waters as far north as the Ryukyu Islands and the southern parts of Japan. The longitudinal coordinates for this area are 25 N - 35 S.

Biogeographic Regions: oriental (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Gulf of Thailand to southwestern Palau, north to southern Japan, south to Java, Indonesia.
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Tomato clownfish have a distinct orange body, which may turn black in older individuals. Behind the head of the fish, a black-edged bar extends from the top of the head towards the belly. A second black-edged white bar may be found around the mid-section of the body.

Amphiprion frenatus have 9-10 dorsal-fin spines and 16-18 dorsal soft rays. This species also has 2 anal-fin spines and 13-15 anal soft rays.

Tomato clownfish can grow up to 14 cm in length. Females are larger than males.

Range length: 14 (high) cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 9 - 10; Dorsal soft rays (total): 16 - 18; Analspines: 2; Analsoft rays: 13 - 15
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 140 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Overall color is orange, with a black-edged bar just behind the head. Body sometimes black especially in older individuals. A second black-edged white bar maybe at mid-body (Ref. 7247). Body depth 1.7-2.0 in SL (Ref. 90102).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Neotype for Amphiprion frenatus
Catalog Number: USNM 71702
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Gilbert, J. Snyder, M. Sindo, H. Heath, C. Burke, H. Torrey & A. Clark
Year Collected: 1906
Locality: Nafa [sic], Okinawa, Lu chu Islands [sic], Japan., Okinawa, Japan, Ryukyu Islands, Pacific
Vessel: Albatross
  • Neotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Tomato clownfish are known to inhabit lagoon reefs, particularly with embayments. According to Fautin and Allen (1992), this species does not migrate, and has developed a relationship with the anemone Entacmaea quadricolor.

Range depth: 1 to 12 m.

Habitat Regions: tropical

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 12 m (Ref. 7247)
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 1 - 14
  Temperature range (°C): 26.960 - 28.409
  Nitrate (umol/L): 0.498 - 0.617
  Salinity (PPS): 33.721 - 34.192
  Oxygen (ml/l): 4.447 - 4.578
  Phosphate (umol/l): 0.071 - 0.284
  Silicate (umol/l): 1.174 - 4.892

Graphical representation

Depth range (m): 1 - 14

Temperature range (°C): 26.960 - 28.409

Nitrate (umol/L): 0.498 - 0.617

Salinity (PPS): 33.721 - 34.192

Oxygen (ml/l): 4.447 - 4.578

Phosphate (umol/l): 0.071 - 0.284

Silicate (umol/l): 1.174 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 12m.
From 1 to 12 meters.

Habitat: reef-associated. Found in lagoon reefs and embayments, associated with the anemone @Entacmaea quadricolor@, and possibly other anemones.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Tomato clownfish eat algae, zooplankton, and small, aquatic crustaceans.

A characteristic of all anemonefish belonging to the genus Amphiprion is that they are mutualistic with anemones. This means that they live together with large anemones, and each helps the other species. When a tomato clownfish brings food back to an anemone, the anemone is rewarded with crumbs from the meal. In turn, the fish is protected from predators while within the anemone. The anemonefish also help the anemones by cleaning and caring for them, which again benefits the anemone greatly.

Animal Foods: aquatic crustaceans; zooplankton

Plant Foods: algae

Primary Diet: herbivore (Algivore); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds on plants and invertebrates (Ref. 6110). Found in lagoon reefs and embayments, associated with the anemone Entacmaea quadricolor, and possibly other anemones. Has been reared in captivity (Ref. 35413, 35415, 35418, 35420).
  • Sano, M., M. Shimizu and Y. Nose 1984 Food habits of teleostean reef fishes in Okinawa Island, southern Japan. University of Tokyo Bulletin, no. 25. v,128p. University of Tokyo Press, Tokyo, Japan. 128 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Amphiprion frenatus is a symbiont to the bulb-tentacle sea anemone, Entacmaea quadricolor. Although they can both live without each other, their health and rate of survival are increased when tomato clownfish live within its tentacles.

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In all of the literature available, no specific predators were given for the tomato clownfish or even for their genus, Amphiprion.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 2000 Diseases in marine aquarium fish: causes, development, symptoms, treatment. Bassleer Biofish, Westmeerbeek, Belgium, 96 p. Second edition. (Ref. 41806)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uronema infection. Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 2000 Diseases in marine aquarium fish: causes, development, symptoms, treatment. Bassleer Biofish, Westmeerbeek, Belgium, 96 p. Second edition. (Ref. 41806)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coral fish Disease. Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 2000 Diseases in marine aquarium fish: causes, development, symptoms, treatment. Bassleer Biofish, Westmeerbeek, Belgium, 96 p. Second edition. (Ref. 41806)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Not much is known about the communication of tomato clownfish, except that when they are either defending themselves or attacking others, they will make a "tack-tack" sound.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Beginning as an egg, tomato clownfish will take about one week to hatch and become larvae. After hatching, larvae will drift for about 16 days in plankton-rich waters. At the end of this drifting journey, the larvae will look for anemones of their own to inhabit. Their development from there depends upon social roles. A juvenile will only develop into a sexually mature male if this role in the anemone is not already filled. When the female of the anemone is absent, the largest mature male will then change into the sexually mature female.

Damselfishes that live in anemones have biological attributes that help them to live in this unique environment. As they mature, they gain a special mucus coat that has specific chemicals that counter the anemone's sting. These fishes are also known to have a special swimming pattern that helps them to survive in the anemone.

According to Wickler (1963), Amphiprion frenatus, like other anemonefishes, is not immune to the anemone, but instead stimulates the nematocysts (stinging cells) to fire. If these fish choose to live outside of an anemone, they usually take up residence in coral branches.

It is possible to make a general guess at the age of tomato clownfish by the stripes on their bodies. When young, these fish will have more white stripes on their hind regions. However, not all individuals lose the juvenile pattern as they mature.

  • Myers, R. 1999. Micronesian Reef Fishes: A Field Guide for Divers and Aquarists. Territory of Guam: Coral Graphics.
  • Allen, G. 1997. Marine Fishes of Tropical Australia and South-East Asia. Perth, Western Australia: Western Australian Museum.
  • Wickler, W. 1963. The Marine Aquarium. Stuttgart: T.F.H. Publications, Inc Ltd..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Benthic spawner. Length at sex change = 6.6 cm TL (Ref. 55367). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Also Ref. 240, 7471.
  • Moyer, J.T. and A. Nakazono 1978 Protandrous hermaphroditism in six species of the anemonefish genus Amphiprion in Japan. Jap. J. Ichthyol. 25(2):101-106. (Ref. 32166)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The knowledge surrounding longetivity for this species is sparse, even though more is known about this species than other anemonefishes. At most, they live 6-10 years in teh wild, and 18 years in captivity.

Average lifespan

Status: wild:
6-10 years.

Range lifespan

Status: captivity:
18 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

A pair of tomato clownfish will mate for life. However, if one partner leaves, then the other will find a replacement for its lost mate.

Mating System: monogamous

One of the most interesting characteristics of anemonefishes is that all offspring are born male, and mature as such. Therefore, all females are sex-reversed. This sexual metamorphosis occurs when the female of a group leaves. This will trigger the largest male remaining to switch sexes and will allow the largest juvenile to become a mature male. The adult pair will then continue to stunt the growth of the remaining offspring.

When courting a female, a male will exhibit both sterotyped and ritualised behavior. A male will chase a female, as he becomes more bold. He also has the tendancy to show off for his mate by erecting his dorsal, anal, and pelvic fins as he remains in one spot near her, much like a statue. Another form of behavior recorded among A. frenatus is "signal jumping," which means that a male will move rapidly around an anemone in an up and down manner. In the beginning of their courtship, a male will also spend a large amount of time picking out the nesting site that he will eventually guard if he is successful in mating with a female. At the end of courtship, she will also help her mate in clearing the nesting site of algae and other debris. When laying eggs, a female will place the adhesive eggs on a rock near the anemone. The male then watches over them until they hatch.

Tomato clownfish, like all Amphiprion, will breed all year long in the tropics, but only in the warmer months of temperate locations. Spawning occurs during a full moon, which is characteristic of all anemomefishes.

Breeding interval: Tomato clownfish, like all Amphiprion, will breed all year long in the tropics, but only in the warmer months of temperate locations.

Breeding season: Spawning occurs during a full moon, which is characteristic of all anemome fishes.

Range number of offspring: 100 to >1,000.

Average gestation period: 6-7 days.

Average time to independence: 8-12 days.

Key Reproductive Features: year-round breeding ; sequential hermaphrodite (Protandrous ); sexual ; oviparous

After the eggs are laid near the host anemone, the male looks after the eggs, and both the male and female will protect the eggs as well. After the larvae hatch, they swim away to find an anemone of their own to inhabit, and no further care is given by the parents.

Parental Investment: pre-hatching/birth (Protecting: Male, Female)

  • Myers, R. 1999. Micronesian Reef Fishes: A Field Guide for Divers and Aquarists. Territory of Guam: Coral Graphics.
  • Wickler, W. 1963. The Marine Aquarium. Stuttgart: T.F.H. Publications, Inc Ltd..
  • Fautin, D., G. Allen. 1992. Field Guide to Anemone Fishes and Their Host Sea Anemones. Perth: Western Australian Museum. Accessed October 29, 2004 at http://biodiversity.uno.edu/ebooks/intro.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiprion frenatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTAATTTTCGGTGCTTGAGCTGGGATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTCTTAGGAGATGATCAGATTTATAACGTTATTGTTACCGCACATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTCTAATTGGAGGATTTGGAAACTGACTAGTACCCCTTATGCTTGGCGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCTTTCCTTCTTCTGCTTGCCTCTTCAGGCGTTGAAGCTGGGGCCGGAACAGGCTGAACTGTATACCCACCACTGTCTGGAAACCTAGCCCATGCAGGAGCATCAGTAGACTTAACTATCTTCTCCCTCCACCTGGCAGGTGTCTCATCAATCCTGGGAGCAATTAACTTTATTACCACCATTATTAACATGAAACCCCCCGCCATCACACAGTATCAAACCCCCCTATTTGTTTGAGCTGTCCTAATTACTGCTGTTCTTCTTCTCCTTTCTCTCCCAGTTTTAGCTGCTGGTATTACTATGCTCCTAACTGACCGAAATCTAAATACTACTTTCTTTGACCCCGCAGGGGGAGGAGACCCTATTCTTTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amphiprion frenatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This species is not listed on any of the endangered or threatened lists that are listed below.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

No literature found stated that tomato clownfish have a negative economic importance for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tomato clownfish have a positive economic importance for humans through the pet trade industry.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tomato clownfish

The tomato clownfish, Amphiprion frenatus, is a clownfish that is found in the waters of the Western Pacific, from the Ryukyu Islands, Japan, to Malaysia and Indonesia.[1] It is also known as the bridled clownfish, red clownfish, or tomato anemonefish.

The adult fish is bright orange-red, with one white vertical stripe just behind the eyes, joined over the head. Some varieties have darker coloration or dark spots on their flanks. Juveniles are a darker red, with three vertical white bands and black pectoral fins.

They can grow to 14 cm (5.5 in) in length, however the female is usually larger than the male.[2][3] The eggs are deposited on a flat surface and tended by the pair until they hatch (6 to 11 days). They prefer to nestle in purple anemones such as the bubble-tip anemone, Entacmaea quadricolor, or the Sebae anemone, Heteractis crispa.[2]

In the wild, the species eats zooplankton and algae, being an omnivorous species.[2]

In captivity[edit]

As a pet, many marine hobbyists agree that at least 20 US gallons (76 L) of tank volume is necessary for the fish, however others believe larger is necessary for this fish to have ample room for maneuvering. Many hobbyists use a quarantine tank prior to introduction into the main tank as it helps to rid the Tomato Clownfish of saltwater-borne diseases.

This species of fish thrives well even without a host anemone. In the absence of a host, it may "adopt" corals of a tank to reside.[2] It will eat most meat or vegetable food preparations, including dried algae, mysis shrimp, and brine shrimp.[2] The tomato clownfish has been reported to be aggressive and territorial when mature, and specimens have been known to be extremely aggressive even towards clownfishes of other species. For this reason, it is best kept singly or in mated pairs; some claim that it will cohabit with other clownfish varieties if they are introduced at the same time.[citation needed] The Tomato clownfish has successfully been bred and raised in captivity;[2] the fry can be fed on baby brine shrimp and rotifers.

References[edit]

  1. ^ "Facts about Tomato Clownfish (Amphiprion frenatus) - Encyclopedia of Life". Eol.org. Retrieved 2014-01-27. 
  2. ^ a b c d e f Lougher, Tristan (2006). What Fish?: A Buyer's Guide to Marine Fish. Interpet Publishing. p. 14. ISBN 0-7641-3256-3. 
  3. ^ "Amphiprion frenatus, Tomato clownfish : aquarium". Fishbase.org. 2012-07-03. Retrieved 2014-01-27. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!