Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Clear coastal to outer reef slopes and drop-offs (Ref. 48636). Found around staghorn corals. The only member of the family with a crosshatch pattern of dark lines on the sides. Generally seen below 15 m depth and occurs singly or in pairs. Feed on small benthic invertebrates and algae, similar to C. mertensii (Ref. 37816). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed around the western Pacific Ocean rim, from southern Japan including the Izu Islands south to the Philippines and Indonesia (Allen 1980, Pyle 2001, G.R. Allen pers. comm. 2006). It occurs in Palau as a vagrant (R. Myers pers. comm. 2009). It is found at depths between 10-50 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Indonesia and the Philippines, north to the Ryukyu Islands (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 14; Dorsal soft rays (total): 20 - 23; Analspines: 3; Analsoft rays: 15 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 140 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

14.0 cm SL (male/unsexed; (Ref. 4858))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Posterior part of body and tail orange-yellow (Ref. 48636). Body pearly white; scales have black edges, giving the sides a reticulated pattern (Ref. 4855). Vertical bar broad orange across posteriormost of body; eye bar black; forehead spot black with pale edge. Snout length 2.8-3.6 in HL. Body depth 1.6-1.8 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Populations of this species are typically found on outer reef slopes and drop-offs among live coral. Animals usually occur alone or in pairs, roaming widely across reefs in search of food (small benthic invertebrates and algae). The juveniles are shy, solitary, and tend to be restricted to confined areas close to shelter (G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 8.5 - 25

Graphical representation

Depth range (m): 8.5 - 25
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 6 - 50 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 8.5 - 25

Graphical representation

Depth range (m): 8.5 - 25
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Among coral reefs (Ref. 9137). Found around staghorn corals. The only member of the family with a crosshatch pattern of dark lines on the sides. Generally seen below 15 m depth and occurs singly or in pairs. Feeds on small benthic invertebrates and algae, similar to C. mertensii (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon xanthurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGTGGGCACCGCTTTAAGTCTACTTATCCGAGCAGAGCTCAGTCAACCAGGCTCCCTTCTAGGCGACGATCAGATCTATAATGTAATCGTTACGGCACATGCGTTCGTGATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTAATTCCTCTAATGATTGGGGCCCCTGATATAGCCTTCCCTCGCATGAACAACATGAGCTTTTGACTTCTGCCCCCTTCCTTCTTCTTACTACTTGCCTCTTCAGGCGTAGAATCTGGGGCCGGTACCGGGTGAACGGTATATCCCCCGTTAGCCGGTAATCTGGCACACGCCGGAGCGTCCGTTGATCTTACCATCTTCTCCCTCCACCTCGCTGGGATTTCCTCTATTCTTGGGGCCATCAATTTCATCACAACCATCCTCAATATAAAACCCCCCGCTATGTCCCAGTATCAAACCCCCCTCTTCGTATGATCCGTTCTAATTACAGCTGTTCTGCTTCTTCTGTCCCTTCCGGTTCTGGCAGCCGGAATTACAATACTCCTAACAGACCGAAACTTAAACACAACCTTCTTCGACCCAGCAGGAGGTGGCGACCCAATTCTGTATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon xanthurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and generally abundant. There do not appear to be any major threats to this species.It is collected for the aquarium trade. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is generally common. There is no reason to believe that it is declining (or increasing).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species. There is collection for the aquarium trade, but it is not thought to have an impact on the global population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There appear to be no species-specific conservation measures in place (G.R. Allen pers. comm. 2006). It seems probable that the range falls into marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pearlscale butterflyfish

The Pearlscale Butterflyfish (Chaetodon xanthurus) is a species of butterflyfish (family Chaetodontidae) also known as Yellow-tailed Butterflyfish or Philippines Chevron Butterflyfish (the Chevron Butterflyfish is an unrelated species of Chaetodon). It is found on or around the reefs of the central Indo-Pacific region from Indonesia and the Philippines north to the Ryukyu Islands.[2]

In the wild adults can grow to 15 cm with no discernible differences between males and females. The body is pearly white and the scales have black edges, giving the sides a more cross-hatched pattern instead of the clear chevrons in related species. The hind parts are orangey-yellow, the base of the caudal fin is white. The head is darker than the body and bears the characteristic pattern of its lineage, consisting of vertical black eyestripes and a black white-rimmed crown spot.[2]

Ecology in the wild and the aquarium[edit source | edit]

Pearlscale butterflyfish are a diurnal species and usually found at depths below 15 m (49 ft). They are found in clear coastal to outer reef slopes and drop-offs, often around Acropora staghorn corals. These fish have a peaceful temperament and in the wild are found either alone, in pairs, or in small groups, however they are territorial towards similar-looking species and may harass them. Due to its attractive colors, the Pearlscale Butterflyfish is a well-known aquarium fish. A 50 gallon aquarium is the minimum size recommended for them, with a water temperature of between about 74 and 80° F. Although they can be aggressive at times, they are delicate and peaceful tankmates are required for this fish to thrive in an aquarium. They may be compatible with other butterflyfishes that have a different color pattern, but there is no guarantee that their relationship will always be peaceful. When adding more than one to a tank they have to be added simultaneously, and lots of "living rock" with shelters available for them to hide helps to reduce stress.

In the wild they feed on algae, soft coral polyps and small benthic invertebrates, so therefore along with other coral-eating Chaetodon species they can wreak havoc on living corals in the aquarium. They should be fed a variety of foods that can include mysid shrimp, brine shrimp, krill, spirulina and foods containing algae.

Systematics[edit source | edit]

C. xanthurus is one of the "crowned" butterflyfishes. These form a group of largely allopatric species sharing the overall color pattern of dark forward-pointing chevrons on silvery hues, (usually) a black-and-white crown spot and yellow to red hindparts to a stunning degree; they differ in the exact combination of hues and some small pattern details. Other members of this lineage are the Atoll (C. mertensii), Eritrean (C. paucifasciatus) and Seychelles butterflyfishes (C. madagaskariensis), which are closer related among each other that any is to C. xanthurus.[3]

The "crowned" Chaetodon are a clearly recognizable clade, but their further relationships are otherwise less clear. They were often placed in the subgenus Exornator, or considered a distinct subgenus Rhombochaetodon. According to various DNA sequence studies, some older and more singular lineages. These include species such as the Asian Butterflyfish (C. argentatus), the Blue-striped Butterflyfish (C. fremblii) and Burgess' Butterflyfish (C. burgessi). C. burgessi is in fact so peculiar that it was placed in a monotypic subgenus Roaops. But recognition of this would probably result in several other small or monotypic subgenera becoming justified, and the older Rhombochaetodon would be the more conveniently apply to the entire radiation.[3]

But the expanded group is of unclear relationships to species like the Speckled Butterflyfish (C. citrinellus) and the Four-spotted Butterflyfish (C. quadrimaculatus). These might be members of the subgenus Exornator – the lineages around the Spot-banded Butterflyfish (C. punctatofasciatus) – and C. citrinellus certainly looks somewhat similar to these. Yet phylogenetically, their position towards Rhombochaetodon is unresolved, and ultimately it might be better to merge both Rhombochaetodon and Roaops in Exornator. If the genus Chaetodon is split up, Exornator might become a subgenus of Lepidochaetodon or a separate genus.[3]

Footnotes[edit source | edit]

  1. ^ Myers, R. & Pratchett, M. 2010. Chaetodon xanthurus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 10 September 2013.
  2. ^ a b FishBase (2008)
  3. ^ a b c Fessler & Westneat (2007), Hsu et al. (2007)

References[edit source | edit]

  • Fessler, Jennifer L. & Westneat, Mark W. (2007): Molecular phylogenetics of the butterflyfishes (Chaetodontidae): Taxonomy and biogeography of a global coral reef fish family. Mol. Phylogenet. Evol. 45(1): 50–68. doi:10.1016/j.ympev.2007.05.018 (HTML abstract)
  • FishBase (2008): Chaetodon xanthurus. Version of 2008-JAN-14. Retrieved 2008-SEP-01.
  • Hsu, Kui-Ching; Chen, Jeng-Ping & Shao, Kwang-Tsao (2007): Molecular phylogeny of Chaetodon (Teleostei: Chaetodontidae) in the Indo-West Pacific: evolution in geminate species pairs and species groups. Raffles Bulletin of Zoology Supplement 14: 77-86. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!