Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

WhyReef - Lifestyle

Clown anemonefish live with a group of other clownfish in their anemone. Anemones are animals that don’t have a skeleton inside their bodies (invertebrates). They have nematocysts, or stinging cells, that they use to catch and eat other fish. The stinging cells don’t hurt clownfish, because they have a protective slime layer that keeps them from getting stung. They live in a symbiotic, or close, relationship with their anemone. By living in the anemone they are protected from most all of their predators. In return the anemone eats scraps of food the clownfish drop, and is protected from predators like butterflyfish and turtles! Because the clownfish and anemones help each other out, their relationship is mutualistic.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Adults inhabit coral reefs where it lives among the venomous tentacles of large sea anemones (Ref. 85309). Occur in shallow and calm lagoons. Are protandrous hermaphrodites (Ref. 32167). Distinct pair is monogamous (Ref. 32167). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). One of the most popular marine aquarium fishes. Bred artificially in Florida for the aquarium trade. Associated with the anemones: Heteractis magnifica, Stichodactyla gigantea, and Stichodactyla mertensii (Ref. 5911). Has been reared in captivity (Ref. 35410, 35413, 35415, 35418, 35420). Has reached an age of 12 years in captivity (Alexandre Fontayne, pers. comm., 2006).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Fun Facts

The clown anemonefish is famous: it is the same species as the hero “Nemo” from the movie Finding Nemo.

All clownfish are born males and only some become females later in life. They live in small groups with the females in charge. If a large female dies then the largest male will become a female!

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: eastern Indian Ocean including Andaman and Nicobar Islands, Thailand, Malaysia, and northwest Australia to Singapore, Indonesia, and the Philippines; ranges north to Taiwan and the Ryukyu Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Amphiprion ocellaris (Cuvier 1830), the false clownfish, is a tropical marine fish found in parts of Asia and Australia. Its range includes Northwest Australia, Southeast Asia, and as far north as the Ryukyu Islands of Japan (Allen 1997).

Biogeographic Regions: oriental (Native ); australian (Native ); pacific ocean (Native )

  • Allen, G. 1997. Marine Fishes of Tropical Australia and South-East Asia. Perth: Western Australian Museum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10 - 11; Dorsal soft rays (total): 13 - 17; Analspines: 2; Analsoft rays: 11 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

False clownfish are orange to reddish-brown with three white bands on the head and body. The white bands are outlined in black. Black A. ocellaris, with white bands and black coloring instead of orange, are found off the Northern Territory of Australia (Allen 1997). Amphiprion ocellaris has a rounded caudal fin and may grow up to 110 mm in length (Nelson et al. 1996). There are 11 dorsal spines and 17 pectoral rays that help to distinguish it from the closely related Amphiprion percula. Females are larger than males in this species.

Range length: 110 (high) mm.

Average length: 80 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Nelson, J., P. Phang, L. Chou. 1996. Survival and growth rates of the anemonefish Amphiprion ocellaris: a transfer experiment. Journal of Fish Biology, 48: 1130-1138.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 110 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Easily identified by the orange color and three white bands, the middle one widening forward to the head centrally (Ref. 48636). Caudal fin rounded.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 15 m (Ref. 7247), usually 3 - 15 m (Ref. 55267)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amphiprion ocellaris inhabits coral reefs (Allen 1997) and sheltered lagoons up to a depth of 15 meters (Myers 1999). More specifically, it is mainly found in or near the anemones Heteractis magnifica, Stichodactyla gigantean, and Stichodactyla mertensii (Myers 1999) as part of a symbiotic relationship.

Range depth: 15 to 1 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef

  • Myers, R. 1999. Miconesian Reef Fish: A Field Guide for Divers and Aquarists. Barrigada: Territory of Guam: Coral Graphics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 1 - 31
  Temperature range (°C): 25.894 - 29.241
  Nitrate (umol/L): 0.075 - 0.806
  Salinity (PPS): 32.019 - 34.520
  Oxygen (ml/l): 4.149 - 4.703
  Phosphate (umol/l): 0.089 - 0.415
  Silicate (umol/l): 2.957 - 6.058

Graphical representation

Depth range (m): 1 - 31

Temperature range (°C): 25.894 - 29.241

Nitrate (umol/L): 0.075 - 0.806

Salinity (PPS): 32.019 - 34.520

Oxygen (ml/l): 4.149 - 4.703

Phosphate (umol/l): 0.089 - 0.415

Silicate (umol/l): 2.957 - 6.058
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: demersal. Inhabits shallow and calm lagoons, living commensally with the anemones @Stoichactis kenti@, @Stichodactyla gigantea@, @S. mertensii@, and @Heteractis magnifica@. One of the most popular marine aquarium fishes; most specimens in the aquarium trade are @A. ocellaris@ rather than @A. percula@. Bred artificially in Florida for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Planktonic food such as zooplankton, copepods, and algae are the primary source of food for A. ocellaris (Myers 1999). They are classified as generalized omnivores as they feed on equal amounts of algae and animals (Sano et al. 1984). They are also reported to consume parasites from their host anemones (Thresher 1984). Feeding is also dominated by the hierarchical structure of the group dynamics in the anemone. Because the smaller fish receive the most aggression from the others, they have reduced energy for foraging great distances from the anemone and tend to stay close. Additionally, it is unsafe for the smaller fish to stray farther from the safety of the anemone (Fautin and Allen 1992). The large, dominant fish will forage at greater distances, but generally no farther than several meters from the anemone.

Animal Foods: aquatic crustaceans; zooplankton

Plant Foods: algae

Primary Diet: planktivore

  • Sano, M., M. Shimizu, Y. Nose. 1984. Food habits of teleostean reef fishes in Okinawa Island, Southern Japan. Japan: University of Tokyo Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Occurs inshore, commensal with anemones (Ref. 75154). Feeds on plants (34%), benthic invertebrates (44%), and zooplankton (Ref. 6110).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

As mentioned previously (Behavior), A. ocellaris is part of a symbiotic relationship between three species of sea anemones, Heteractis magnifica, Stichodactyla gigantean, and Stichodactyla mertensii (Myers 1999). In this relationship, the fish receives protection from the anemone in the form of daily shelter and for its nest. The anemone receives protection too, as it has been documented that in the absence of a guest fish, the anemones may be attacked by butterfly fish or even turtles (MarineBio 1998). Additionally, in the presence of the fish, bulbs are found on the end of tentacles that are believed to increase surface area available to solar energy (Fautin and Allen 1992). The bulbs are not present in the absence of the fish.

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predation on anemonefishes is greatly reduced due to the relationship with the host anemone, whose sting deters potential predators. The eggs are more susceptible to predation, mainly by other damselfishes (Pomacentridae) not including other anemonefishes, and wrasses (Labridae) (Arvedlund et al. 2000). Egg predation susceptibility increases at night as the male is not guarding them and they may fall victim to brittle stars (Ophiotrichidae) (Arvedlund et al. 2000).

Known Predators:

  • Arvedlund, M., I. Bundgaard, L. Nielsen. 2000. Host imprinting in anemonefishes (Pisces: Pomacentridae): does it dictate spawning site preferences?. Environmental Biology of Fishes, 58: 203-213.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Menu

Clown anemonefish munch on turf algae and zooplankton. Turf algae is a mix of small marine plants, and zooplankton are a mix of tiny and microscopic animals. Clown anemonefish also love feasting on small shrimp. Because they eat both plants and animals, they are carnivores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication during mating occurs through the male biting, chasing, and extending his fins towards the female (Thresher 1984). The hierarchical system is communicated through aggression by the larger members residing in the anemone at the smaller individuals. Ampiprion ocellaris is able to find host anemones by olfactory imprinting that occurs while in the nest (Arvendlund and Nielsen 1996).

Communication Channels: visual ; tactile

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Benthic spawner. Length at sex change = 4.4 cm TL (Ref. 55367). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Also Ref. 240, 7471.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Amphiprion ocellaris hatches and enters a short larval stage where it resides close to the surface in a planktonic stage. As they change from larvae to juvenile fish, usually within a day, the fish moves from the surface to the bottom in search of a host anemone (Fautin and Allen 1992).

Development - Life Cycle: metamorphosis

  • Fautin, D., G. Allen. 1992. Field Guide to Anemonefishes and their Host Sea Anemones. Perth: Western Australian Museum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Lifespan has not been studied fully in the wild, but it is believed that A. ocellaris may live 6-10 years (Fautin and Allen 1992). Larval fish are extremely susceptible to predation as they have no way of defending themselves and have high mortality rates. Captivity transfer experiments have been performed to address the possibility of restocking the fish in areas where they have been depleted; these find that survival among transferred fish is higher among smaller A. ocellaris (Nelson et al. 1996).

Typical lifespan

Status: wild:
6 to 10 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Information specifically for A. ocellaris mating habits is not available, but general behavior believed to be typical of all anemonefishes is documented. They are territorial to the specific anemone they inhabit and are monogamous (Thresher 1984). Prior to spawning, nest preparation is done by the male, where substrate is cleared to make a nest on bare rock, but near enough to the anemone to still have protection from the overhanging tentacles (Thresher 1984). Males will attract the female by extending fins, biting, and chasing (Fautin and Allen 1992). During spawning, the males are increasingly aggressive.

Mating System: monogamous

Amphiprion ocellaris is part of a the subfamily Amphiprioninae, or anemonefishes. This group is characterized by being protandrous hermaphrodites, meaning that all individuals develop first into males and then possibly into females later (Myers 1999). An adult male and female and several juveniles may reside together in an anemone. If the female were to be removed or die, the largest male would then become the female, with the larger of the immature fish transforming into a male. Females control males with aggressive dominance, thus controlling the creation of other females (Fricke and Fricke 1977). The largest male will in turn dominate the juveniles and prevents other males from spawning (Fricke and Fricke 1977).

Amphiprion ocellaris is able to breed nearly year round because it inhabits tropical waters (Thresher 1984) but may be somewhat limited in the northern reaches of its distribution during winter months. Spawning is concentrated around the full moon and usually occurs in the morning. Possible reasons for this include: stronger water currents for larval distribution, greater food supplies due to invertebrate spawning at the same time, and overall increased visibility (Thresher 1984).

When spawning is about to occur, the male will chase the female to the nest, but the female actually begins the process. The female makes several passes over the nest and eventually lays orange eggs over the period of 1-2 hours before leaving the nest (Thresher 1984). Eggs are approximately 3-4 mm in length and range in number from 100-1000 depending on the age of the fish (Fautin and Allen 1992). The male then continues the process as he passes over the eggs, fertilizing them. Eggs are attached to the substrate with a fine thread. Incubation is affected by water temperature, the cooler the water, the longer incubation period, but in general it requires 6-8 days before hatching occurs (Thresher 1984). The planktonic larval stage lasts from 8-12 days and ends when the juvenile fish settle returns to the bottom and attempt to find an anemone to inhabit.

Breeding season: Spawing occurs year-round in the tropics, but only in warmer months in warm-temperate areas. Spawning occurs near the full moon.

Average time to hatching: 7 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sequential hermaphrodite (Protandrous ); sexual ; fertilization (External ); oviparous

Prior to spawning, males prepare a nest where the eggs will be deposited. Males account for the majority of the egg care, but females are involved sporadically. Main duties include fanning the eggs and eating eggs that are infertile or damaged by fungus (Thresher 1984). Once the eggs hatch into the larval stage, they are independent of the parents.

Parental Investment: pre-fertilization (Protecting: Male); pre-hatching/birth (Protecting: Male)

  • Myers, R. 1999. Miconesian Reef Fish: A Field Guide for Divers and Aquarists. Barrigada: Territory of Guam: Coral Graphics.
  • Thresher, R. 1984. Reproduction in Reef Fishes. New Jersey: T.F.H. Publications, Inc..
  • Fautin, D., G. Allen. 1992. Field Guide to Anemonefishes and their Host Sea Anemones. Perth: Western Australian Museum.
  • Fricke, H., S. Fricke. 1977. Monogamy and sex change by aggressive dominance in coral reef fish. Nature, 266: 830-832.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Amphiprion ocellaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Amphiprion ocellaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTCTTTTCGACTAATCACAAAGACATCGGCACCCTCTATCTAGTATTCGGTGCTTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTTCTTATTCGGGCAGAACTAAGCCAACCAGGCGCACTTCTAGGAGAC---GACCAAATTTATAACGTTATTGTTACCGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATCGGAGGGTTTGGAAACTGACTGGTCCCCCTTATGCTTGGCGCCCCCGACATAGCATTCCCTCGTATAAACAACATAAGCTTCTGATTACTTCCTCCCTCTTTCCTTCTTCTACTCGCCTCCTCAGGAGTTGAAGCAGGTGCCGGAACAGGCTGAACTGTTTATCCTCCACTATCTGGAAACCTAGCCCATGCAGGAGCATCAGTAGACTTAACTATCTTCTCCCTCCATCTGGCAGGTGTTTCATCAATTCTTGGAGCAATTAACTTTATTACCACCATTATTAACATGAAACCCCCCGCCATCACACAGTATCAAACCCCCCTATTCGTGTGAGCTGTTCTGATTACTGCTGTTCTCCTTCTCCTTTCTCTACCAGTCTTAGCTGCCGGCATTACCATGCTCCTAACTGACCGAAATCTAAATACTACTTTCTTTGACCCCGCAGGGGGAGGAGACCCTATTCTTTACCAACACCTTTTCTGATTCTTCGGACACCCAGAAGTTTACATTCTTATCCTGCCAGGATTCGGAATAATTTCCCATATCGTAGCCTACTACTCTGGCAAAAAAGAACCTTTCGGATACATGGGCATGGTTTGAGCAATAATGGCCATTGGCCTATTGGGATTTATTGTGTGAGCCCACCATATGTTTACAGTTGGAATAGATGTAGACACCCGAGCCTATTTCACATCCGCCACGATGATCATTGCCATCCCGACAGGCGTAAAAGTCTTTAGCTGACTAGCCACTCTTCATGGAGGG---ACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The high demand for the A. ocellaris in the aquarium trade has reduced the population size in some locations, leaving the local populations open to over-exploitation and other threats (Nelson et al. 1996). The species is not classified as threatened or endangered (IUCN 2003); however, as threats to coral reefs increase, A. ocellaris may face habitat degradation and possibly be threatened in the future. Coral reefs face many issues including sedimentation, eutrophication, exploitation of resources, and possible sea temperature increases due to global warming (Bhat 2004).

US Federal List: no special status

CITES: no special status

  • Bhat, A. 2004. Coral reefs and their fauna: An underwater fantasyland. Resonance, September: 62-73.
  • IUCN, 2003. "2003 IUCN Red List of Threatened Species" (On-line). Accessed October 22, 2004 at www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Threats

Being famous can be dangerous! Many people want clown anemonefish in their own aquariums. That means that lots of people are catching them to sell, and populations of clownfish have gone down in some areas.

Reefs are in danger, and that means so is the home of the clown anemonefish!

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

None known

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Amphiprion ocellaris are part of the tropical fish aquarium trade and certain rare colors of the species are specifically sought (Sadovy and Vincent 2002). They are easily bred in captivity and may be used in research (Thresher 1984).

Positive Impacts: pet trade ; research and education

  • Sadovy, Y., A. Vincent. 2002. Ecological Issue and the Trade in Live Reef Fishes. Pp. 395 in P Sale, ed. Coral Reef Fishes. San Diego, California: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ocellaris clownfish

Amphiprion ocellaris, also known as the ocellaris clownfish, false percula clownfish or common clownfish, is a marine fish belonging to the family Pomacentridae which includes clownfishes and damselfishes. Amphiprion ocellaris are found in different colors, depending on where they are located. For example, black Amphiprion ocellaris with white bands can be found near northern Australia, Southeast Asia, and Japan.[2] Orange or red-brown Amphiprion ocellaris also exist with three white bands (like mentioned above) spanning from its body and head. Amphiprion ocellaris can be distinguished from other Amphriphon fish based on the number of pectoral rays and dorsal spines. Amphiprion ocellaris are known to grow about 110 mm long. Like many other fish species, females are, however, larger than males.[2] The life cycle of Amphiprion ocellaris varies in whether they reside at the surface or bottom of the ocean. When they initially hatch, they reside near the surface. However, when Amphiprion ocellaris enters into the juvenile stage of life, they travel down to the bottom to find shelter from a host anemone.[3] Once they find their anemone, they form a symbiotic relationship with them.[2][4]

Phylogeny[edit]

Ocellaris clownfish in the National Marine Aquarium, Plymouth

The species Amphiprion ocellaris belongs to the class Osteichthyes which contains bony fish and ray-finned fish. A. ocellaris is the most basal species in the genus Amphiprion which is closely related to the genus Premnas. The species' most closely related ancestor is Amphiprion percula, the Orange clownfish. It is thought that A. ocellaris specialized after diverging from the Premnas genus, and scientific evidence confirms that all clownfish belonging to the genus Amphiprion could withstand the stings of only one type of anemone, after further diverging the 28 different species of clownfish including A. ocellaris specialized to be able to resist the poisonous stings of many different species.

Description[edit]

The common clownfish is a small fish which grows up to 11 cm (4.3 inches). Its body has a stocky appearance and oval shape. It is compressed laterally, with a round profile. The coloration of its body is orange to reddish-brown, but it can also be black in some particular areas such as the Northern Territory in Australia.[5] It has three vertical white stripes outlined with a fine black line. The first passes just behind the eye, the second in the middle of the body widens forward to the head centrally and the third one circles the caudal peduncle.[6] All the fins are also outlined with a fine black line. A. ocellaris is often confused with Amphiprion percula, which possesses exactly the same colours and patterns at first sight but distinguishes itself by the thickness of the black outlines.[7]

Distribution and habitat[edit]

This species is found in the Eastern Indian Ocean and in the western Pacific Ocean.[6] As mentioned earlier, they can also be found in Northern Australia, Southeast Asia and Japan.[2]

Amphiprion ocellaris typically lives in small groups on outer reef slopes or in sheltered lagoons at a maximal depth of 15 meters. It inhabits three different species of sea anemones: Heteractis magnifica, Stichodactyla gigantea and Stichodactyla mertensii and have symbiotic relationships with the anemone.[2][4][8]

Behavior[edit]

A. ocellaris is a diurnal fish. It is a protandrous hermaphrodite, which means the male can change its gender to female during its life, and lives in a harem in which an established dominance hierarchy manages the group and keeps individuals at a specific social rank. It is aggressively territorial and is completely dependent on its sea anemone.[8]

Shelter[edit]

A. ocellaris are reliant on sea anemone for shelter (they have a symbiotic relationship with the sea anemone). Sea anemone are protection for the fish and their nests. This is because when A. ocellaris are in the open waters, they have a higher risk of predation. It is postulated that the fanning behavior of the fish and removal of parasites promotes the health of sea anemones which contain A. ocellaris fish. In addition, the anemone provides protection for the fish with its tentacles, however, the fish’s mucus protection prevents it from being stung by the tentacles.[2][4] The presence of the clownfish can be interpreted as a lure to attract potential anemone's preys close to the tentacles. And the clownfish can also defend the anemone against some reef fishes which could eat the tentacles.[8]

Social system[edit]

Social systems can be defined as society considered as a system organized by a characteristic pattern of relationships.[9]A. ocellaris form specific social hierarchies within their societies. These social hierarchies result in competition to travel between the different levels of society, which is seen between various ages as well.

Purple anemone (Heteractis magnifica) and resident anemonefish (Amphiprion ocellaris) (clownfish) in East Timor.

Queue selection[edit]

Queues is the term for social groups of A. ocellaris. This is because these fish form social hierarchies, or social rank, by “outliving” the more dominant members of the group. The dominant pair of each queue reproduces more compared to the subordinate fishes. This is the reason for why these individuals should adopt various tactics in which they increase their probability of attaining social dominance. There are two types of A. ocellaris, settlers and switchers. Settlers prefer shorter queues, while switchers will usually move after settlement. However, studies show that there is no difference in the characteristics between switchers and non-switchers, and there is no data demonstrating that A. ocellaris utilize the switching tactic for dominance. Although settlement preferences increase the likelihood of gaining social dominance, switching could have the function of increasing social dominance benefits after social dominance has been acquired.[10]

Juvenile Amphiprion ocellaris[edit]

Juvenile A. ocellaris have difficulty finding an anemone to live in (since they need anemone for survival and shelter). The difficulty also arises in the fact that there exists a hierarchy in each anemone. Thus, when a new juvenile enters an anemone, it begins at the bottom of the social ladder where it is often the victim of aggression by other clownfish. This aggression from other A. ocellaris in the anemone can cause the juvenile to be chased out of the anemone, and left to search for another anemone[3][4][11][12]

Group size and patch size[edit]

Studies have shown that there is a correlation between the size of the group and the size of the patch; however this correlation provides no implication that subordinate group members have less resources. More likely, it is the effects of the patch size on the group member that dominates interactions. An experiment was performed to study the mechanism responsible for the positive correlation between the group size and patch size. The scientists argued that the correlation between the group size and patch size is because of the indirect consequence of the positive relationship between the dominant group member’s length and the anemone size. The length of the dominant group member limits the group size because the length of the dominant group member prevents the group of the subordinate group members. This data shows that the patch size and group size correlation does not necessarily imply the decrease in resources of group members subordinate to the dominant group member.[13]

Food habits[edit]

A. ocellaris feed on plankton and algae, thus they are considered omnivores. Feeding is also affected by the hierarchy in A. ocellaris groups. Since the smaller, less dominant fish face aggression from the more aggressive fish, they have less energy to forage for food. Thus, they usually do not eat as much as the dominant fish do, because of reduced energy, but also because of the increased danger they face when they leave their anemone since they are smaller. In other words, the larger fish will usually travel farther than the smaller fish. Generally, the A. ocellaris feed on algae, copepods, and zooplankton.[3][4][12][14]

Reproduction and life history[edit]

A. ocellaris have reproductive behaviors very similar to that of all anemone fishes. They have monogamous mating systems, and in their spawning processes, they also have different levels of aggressiveness between males and females. In addition, there is a reproductive hierarchy that exists between age and sex.

Clownfish are initially male; the largest fish in a group becomes female.

Spawning[edit]

There is not much data on the reproduction of A. ocellaris. However, similar behaviors throughout all anemone fishes have been recorded. These fish have monogamous mating systems, and are territorial of their anemone. Males become more aggressive during spawning. Male behavior also changes to attract females: biting, chasing, fin extension. Before spawning, the male prepares the nest near the anemone (so that the tentacles of the anemone can protect the nest). After the male chases the female to the nest, the female begins the spawning process. She lays eggs for about one to two hours, and then leave the nest for the male to fertilize the eggs. The eggs take approximately six to eight days to hatch (this time period can be affected by the temperature of water). Because of the external fertilization, males usually care for the eggs. They also have responsibilities for eating fungi-infected or infertile eggs, and fanning the eggs.[3][12]

Reproductive hierarchy[edit]

All of the individuals first develop into males and then later there is a possibility that they become females (protandrous hermaphrodites). This also can be termed as plasticity in sex differentiation. This is shown when there are males, females, and juveniles together in an anemone. In the social groups, the female is the dominant and largest member, with signs of aggression towards other members of the social group. The next rank in the social hierarchy were the fishes that will become males and other fishes that stay as non-reproductive.[15] One experiment placed three juvenile anemonefish in a tank and their behaviors were observed over a month. Observations about social rank were made throughout this period, based on interactions with the group. There was also a noticeable correlation between aggressive behaviors and appeasing behaviors. There were many other signs of dominance in this hierarchy, such as the continuous occupation of territory in the tank by the dominant fish, and increase in body mass of the dominant fish compared to that of lower ranked fish (indicating growth suppression). In addition, a difference in certain steroid levels of the fish indicated that there was reproductive suppression also occurring. The individuals that were ranked lower were reproductively suppressed, which was apparent around the first stage of when the group was formed. Gradually, the sex differentiation and dominance were formed after social interactions occurred for awhile.[16] Another experiment performed was if we removed the female from the anemone, then the next dominant male would become the female. There is also a dominance hierarchy that exists here. Females actually utilize aggressive dominance to control the males to prevent the formation of other females, and dominant males prevent juvenile males from mating.[15]

In aquaria[edit]

In nature, the false percula clownfish is hosted by Heteractis magnifica and Stichodactyla gigantea. However, in captivity in a reef aquarium, the false percula is hosted by other species of anemone, including Entacmaea quadricolor. In addition, clownfish may adopt a surrogate host as opposed to an anemone, such as Euphyllia divisa, xenia coral, etc.

Human interaction[edit]

A. ocellaris are utilized as part of the tropical fish aquarium trade. However, only certain colors are in demand. In addition, A. ocellarisare used in research since they can be bred easily.[17] This high demand in trade as been dangerous for A. ocellaris' population due to overexploitation.

Notes[edit]

  1. ^ Bailly, N. (2010). "Amphiprion ocellaris Cuvier, 1830". In Nicolas Bailly. FishBase. World Register of Marine Species. Retrieved 2011-12-19. 
  2. ^ a b c d e f Allen, G. 1997. Marine Fishes of Tropical Australia and South-East Asia. Perth: Western Australian Museum.
  3. ^ a b c d Fautin, D., G. Allen. 1992. Field Guide to Anemonefishes and their Host Sea Anemones. Perth: Western Australian Museum.
  4. ^ a b c d e Myers, R. 1999. Miconesian Reef Fish: A Field Guide for Divers and Aquarists. Barrigada: Territory of Guam: Coral Graphics.
  5. ^ Allen, Marine Fishes of Tropical Australia and South-East Asia,Western Australian Museum,1997,ISBN 9780730987512
  6. ^ a b http://eol.org/pages/212597/details
  7. ^ Vilcinskas, Andreas (2002). La vie sous-marine des tropiques [Marine life of the tropics] (in French). Paris: Vigot. ISBN 2-7114-1525-2. 
  8. ^ a b c http://animaldiversity.ummz.umich.edu/accounts/Amphiprion_ocellaris/
  9. ^ "social system." WordNet 3.0, Farlex clipart collection. 2003-2008. Princeton University, Clipart.com, Farlex Inc. 6 Dec. 2013 http://www.thefreedictionary.com/social+system
  10. ^ Mitchell, Jeremy. "Queue Selection and Switching by False Clown Anemonefish, Amphiprion Ocellaris." Animal Behavior 69 (2005): 643-52. Science Direct. Web.
  11. ^ Arvedlund, M., L. Nielsen. 1996. Do the anemonefish Amphiprion ocellaris (Pisces: Pomacentridae) imprint themselves to their host sea anemone Heteractis magnifica (Athozoa: Actinidae)?. Ethology, 102: 197-211.
  12. ^ a b c Thresher, R. 1984. Reproduction in Reef Fishes. New Jersey: T.F.H. Publications, Inc..
  13. ^ J.S. Mitchell1,2 and L.M. Dill. Behavioural Ecology Research Group, Department of Biological Sciences, Simon Fraser University, Burnaby, BC V5A 1S6, Canada.
  14. ^ Sano, M., M. Shimizu, Y. Nose. 1984. Food habits of teleostean reef fishes in Okinawa Island, Southern Japan. Japan: University of Tokyo Press.
  15. ^ a b Fricke, H., S. Fricke. 1977. Monogamy and sex change by aggressive dominance in coral reef fish. Nature, 266: 830-832.
  16. ^ Iwata, Eri, Yukiko Nagai, Mai Hyoudou, and Hideaki Sasaki. "Social Environment and Sex Differentiation in the False Clown Anemonefish, Amphiprion ocellaris." Zoological Science 25.2 (2008): 123-28. Print.
  17. ^ Sadovy, Y., A. Vincent. 2002. Ecological Issue and the Trade in Live Reef Fishes. Pp. 395 in P Sale, ed. Coral Reef Fishes. San Diego, California: Academic Press.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!