Overview

Comprehensive Description

Biology

Usually inhabits coral-rich areas of drop-offs and steep channel slopes from below the effects of surge to over 25 m. Occurs singly or in small groups, sometimes with other species (Ref. 9710, 48635). A nocturnal species hiding in caves or beneath ledges by day, feeds on plankton such as crab larvae at night.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa south to Natal, South Africa and east to the Line, Society, and Tuamoto islands, north to the Ryukyu Islands, south to the Great Barrier Reef. It has not been reported from the Red Sea, Gulf of Aden, Oman, or the Persian Gulf and is absent in the Hawaiian Islands, Marquesas, Pitcairn Group, and Easter Island (Ref. 12419).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Comores, Kenya, Madagascar, Mauritius, Mozambique, Reunion, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and western Mascarenes east to Line Islands and Tuamotu islands, north to Ryukyu Islands, south to Port Hedland (Western Australia), New Caledonia, Tonga and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 16; Analspines: 4; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 30573))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Pale salmon pink; edges of scales dorsally on body deep blue to black; median fins with broad black outer border. Inner pectoral fin axil naked except for one (rarely two) moderate scales on lower half (Ref. 2334).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Usually inhabits areas of rich coral growth of drop-offs and steep channel slopes from below the effects of surge to over 25 m. Occurs singly or in small groups, sometimes with other species (Ref. 9710). A nocturnal species hiding in caves or beneath ledges by day, feeds on plankton such as crab larvae at night.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 25 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 35 specimens in 1 taxon.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 1 - 475
  Temperature range (°C): 25.709 - 29.336
  Nitrate (umol/L): 0.051 - 0.997
  Salinity (PPS): 33.532 - 35.312
  Oxygen (ml/l): 4.444 - 4.748
  Phosphate (umol/l): 0.092 - 0.222
  Silicate (umol/l): 1.096 - 2.813

Graphical representation

Depth range (m): 1 - 475

Temperature range (°C): 25.709 - 29.336

Nitrate (umol/L): 0.051 - 0.997

Salinity (PPS): 33.532 - 35.312

Oxygen (ml/l): 4.444 - 4.748

Phosphate (umol/l): 0.092 - 0.222

Silicate (umol/l): 1.096 - 2.813
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 25m.
From 1 to 25 meters.

Habitat: reef-associated. Shadowfin soldier.  Bleeker, 1853 The largest species of Myripristis reaching 32 cm. Indo-Pacific south to Natal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Usually inhabits coral-rich areas of drop-offs and steep channel slopes from below the effects of surge to over 25 m. Occurs singly or in small groups, sometimes with other species. A nocturnal species hiding in caves or beneath ledges by day, feeds on plankton such as crab larvae at night (Ref. 12419). Also Ref. 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myripristis adusta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACTTAGTATTTGGCGCCTGAGCCGGGATGGTCGGCACCGCACTAAGCCTTCTTATCCGAGCTGAGCTTAGCCAACCCGGAGCTCTTCTGGGCGACGACCAGATTTATAACGTAATCGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATCGGAGGTTTCGGAAACTGACTTATCCCTCTAATAATTGGTGCCCCCGACATGGCATTCCCTCGAATAAACAATATGAGCTTCTGACTACTCCCTCCTTCCTTCCTACTCCTCCTGGCCTCCTCAGGGGTAGAGGCCGGAGCCGGAACAGGATGAACTGTATACCCGCCTCTAGCAGGAAACCTGGCCCACGCAGGAGCTTCCGTTGATCTTACCATCTTCTCACTTCATCTAGCAGGTATCTCCTCAATTCTAGGGGCAATCAACTTCATCACAACAATTATTAATATGAAACCTCCAGCCATCTCTCAGTACCAAACACCTCTGTTTGTTTGAGCTGTTCTAATTACGGCTGTCCTTCTTCTCCTATCCCTTCCTGTTCTTGCCGCTGGCATCACTATGCTTCTAACTGACCGAAACCTAAATACCACCTTCTTCGACCCAGCTGGAGGTGGAGACCCAATCCTTTATCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Myripristis adusta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Myripristis adusta

Myripristis adusta, common name Shadowfin soldierfish, is a species of soldierfish belonging to the family Holocentridae.

Contents

Distribution

This species grows to a length of 35 centimetres (14 in) TL. The body is oval and laterally compressed and the scales are quite large. The eyes are large, as this fish is mainly nocturnal. The basic colour is pale pink, with deep blue to black scale margins. Median and caudal fins show a broad deep blue to black outer border. These fishes usually aggregate in small groups, often in mixed-species and mainly feed on plankton.

Distribution

Myripristis berndti is widespread in the Indian and Pacific Oceans.

Habitat

This nocturnal species can be found on tropical reefs hiding in caves or under ledges by day, at depths of from 1 to 25 metres (3.3 to 82 ft).

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!