Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Usually inhabits coral-rich areas of drop-offs and steep channel slopes from below the effects of surge to over 25 m. Occurs singly or in small groups, sometimes with other species (Ref. 9710, 48635). A nocturnal species hiding in caves or beneath ledges by day, feeds on plankton such as crab larvae at night.
  • Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa south to Natal, South Africa and east to the Line, Society, and Tuamoto islands, north to the Ryukyu Islands, south to the Great Barrier Reef. It has not been reported from the Red Sea, Gulf of Aden, Oman, or the Persian Gulf and is absent in the Hawaiian Islands, Marquesas, Pitcairn Group, and Easter Island (Ref. 12419).
  • Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and western Mascarenes east to Line Islands and Tuamotu islands, north to Ryukyu Islands, south to Port Hedland (Western Australia), New Caledonia, Tonga and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 16; Analspines: 4; Analsoft rays: 12 - 14
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 30573))
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Pale salmon pink; edges of scales dorsally on body deep blue to black; median fins with broad black outer border. Inner pectoral fin axil naked except for one (rarely two) moderate scales on lower half (Ref. 2334).Description: Characterized by large scales in axil of pectoral fins 1-2 (without small scales); body depth 2.0-2.5 in SL (Ref 90102).
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Usually inhabits areas of rich coral growth of drop-offs and steep channel slopes from below the effects of surge to over 25 m. Occurs singly or in small groups, sometimes with other species (Ref. 9710). A nocturnal species hiding in caves or beneath ledges by day, feeds on plankton such as crab larvae at night.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 25 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 35 specimens in 1 taxon.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 1 - 475
  Temperature range (°C): 25.709 - 29.336
  Nitrate (umol/L): 0.051 - 0.997
  Salinity (PPS): 33.532 - 35.312
  Oxygen (ml/l): 4.444 - 4.748
  Phosphate (umol/l): 0.092 - 0.222
  Silicate (umol/l): 1.096 - 2.813

Graphical representation

Depth range (m): 1 - 475

Temperature range (°C): 25.709 - 29.336

Nitrate (umol/L): 0.051 - 0.997

Salinity (PPS): 33.532 - 35.312

Oxygen (ml/l): 4.444 - 4.748

Phosphate (umol/l): 0.092 - 0.222

Silicate (umol/l): 1.096 - 2.813
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 25m.
From 1 to 25 meters.

Habitat: reef-associated. Shadowfin soldier.  Bleeker, 1853 The largest species of Myripristis reaching 32 cm. Indo-Pacific south to Natal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Usually inhabits coral-rich areas of drop-offs and steep channel slopes from below the effects of surge to over 25 m. Occurs singly or in small groups, sometimes with other species. A nocturnal species hiding in caves or beneath ledges by day, feeds on plankton such as crab larvae at night (Ref. 12419). Also Ref. 58534.
  • Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myripristis adusta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACTTAGTATTTGGCGCCTGAGCCGGGATGGTCGGCACCGCACTAAGCCTTCTTATCCGAGCTGAGCTTAGCCAACCCGGAGCTCTTCTGGGCGACGACCAGATTTATAACGTAATCGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATCGGAGGTTTCGGAAACTGACTTATCCCTCTAATAATTGGTGCCCCCGACATGGCATTCCCTCGAATAAACAATATGAGCTTCTGACTACTCCCTCCTTCCTTCCTACTCCTCCTGGCCTCCTCAGGGGTAGAGGCCGGAGCCGGAACAGGATGAACTGTATACCCGCCTCTAGCAGGAAACCTGGCCCACGCAGGAGCTTCCGTTGATCTTACCATCTTCTCACTTCATCTAGCAGGTATCTCCTCAATTCTAGGGGCAATCAACTTCATCACAACAATTATTAATATGAAACCTCCAGCCATCTCTCAGTACCAAACACCTCTGTTTGTTTGAGCTGTTCTAATTACGGCTGTCCTTCTTCTCCTATCCCTTCCTGTTCTTGCCGCTGGCATCACTATGCTTCTAACTGACCGAAACCTAAATACCACCTTCTTCGACCCAGCTGGAGGTGGAGACCCAATCCTTTATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myripristis adusta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Randall, J.E. 1984 Holocentridae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean fishing area 51. Vol. 2. (Ref. 3418)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Myripristis adusta

Myripristis adusta, common name Shadowfin soldierfish, is a species of soldierfish belonging to the family Holocentridae.

Distribution[edit]

This species grows to a length of 35 centimetres (14 in) TL. The body is oval and laterally compressed and the scales are quite large. The eyes are large, as this fish is mainly nocturnal. The basic colour is pale pink, with deep blue to black scale margins. Median and caudal fins show a broad deep blue to black outer border. These fishes usually aggregate in small groups, often in mixed-species and mainly feed on plankton.

Distribution[edit]

Myripristis berndti is widespread in the Indian and Pacific Oceans.

Habitat[edit]

This nocturnal species can be found on tropical reefs hiding in caves or under ledges by day, at depths of from 1 to 25 metres (3.3 to 82 ft).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!