Overview

Comprehensive Description

Biology

Adults inhabit reef flats and lagoon reefs. Frequently occur in colonies associated with live or dead branching staghorn coral (Acropora). Feed on algae, gastropods, sponges, and copepods. Territorial, maintain and 'weed' filamentous algae patches growing on dead coral (Ref. 9710). They attack human intruders without hesitation, sometimes taking painful nips. Particularly aggressive during reproductive periods. The species emit clicking noises during aggressive encounters. Oviparous, males tend the nest visited by several females (Ref. 59295).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa to the Line, Marquesan, and Tuamoto islands, north to the Ryukyu and Bonin islands, south to New Caledonia and Tonga; throughout Micronesia. Excluding the Hawaiian Islands (Ref. 7247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Comores, Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Somalia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Tuamotu Archipelago, north to Wake Atoll, south to Western Australia, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 15 - 17; Analspines: 2; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 140 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 4391))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adults generally brown; dorsal part of head and nape darker, grading to tan on lower part of head and breast. The scales have darker brown margins. The lips are whitish lips; the suborbital is mostly blue; the preopercle and opercle scales with blue centers. The median and pelvic fins are brown; the pectorals are dusky; a well-defined dark brown or blackish spot is sometimes present at base of posteriormost dorsal rays, which distinguishes it from S. lividus where the spot is diffuse. Males in courtship or guarding eggs with broad white bar across middle of body and pale blue stripe from mouth to upper part of pectoral fin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A schooling and territorial species which inhabits reef flats and lagoon reefs. Frequently occurs in colonies associated with live or dead branching staghorn coral (@Acropora@). Feeds on algae, gastropods, sponges, and copepods. They attack human intruders without hesitation, sometimes taking painful nips. Particularly aggressive during reproductive periods. The species emit clicking noises during aggressive encounters.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 12 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 210 specimens in 1 taxon.
Water temperature and chemistry ranges based on 186 samples.

Environmental ranges
  Depth range (m): 0.15 - 100
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.043 - 2.714
  Salinity (PPS): 33.898 - 36.148
  Oxygen (ml/l): 4.436 - 5.079
  Phosphate (umol/l): 0.085 - 0.507
  Silicate (umol/l): 1.005 - 4.752

Graphical representation

Depth range (m): 0.15 - 100

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.043 - 2.714

Salinity (PPS): 33.898 - 36.148

Oxygen (ml/l): 4.436 - 5.079

Phosphate (umol/l): 0.085 - 0.507

Silicate (umol/l): 1.005 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 12m.
From 1 to 12 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stegastes nigricans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCCTGAGGCGGGATAGTAGGAACAGCTTTAAGTCTCCTCATTCGGGCAGAACTAAGCCAACCAGGTGCTCTCCTCGGAGACGACCAGATTTACAATGTTATTGTTACAGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGAAATTGACTTATCCCCCTGATGATTGGAGCCCCCGATATGGCTTTCCCTCGAATGAACAACATGAGTTTTTGACTCCTGCCCCCATCATTTCTCCTCCTGCTTGCTTCTTCAGGTGTTGAAGCAGGTGCAGGAACAGGGTGAACTGTATACCCTCCACTCTCTGGCAACTTGGCCCACGCAGGAGCTTCCGTTGACCTAACTATTTTTTCACTTCACCTAGCAGGAATCTCATCCATCCTAGGTGCAATTAACTTTATTACTACAATTATTAATATAAAACCACCCGCTATTTCCCAATACCAAACCCCACTCTTTGTGTGAGCCGTACTAATCACGGCTGTCCTACTACTCCTCTCTCTCCCAGTACTGGCTGCCGGAATCACCATGCTTCTAACGGACCGGAACTTAAACACCACTTTCTTTGACCCTGCAGGAGGAGGAGATCCCATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stegastes nigricans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 46
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Stegastes nigricans

Stegastes nigricans, the dusky farmerfish, is a species of damselfish found around coral reefs at a depth of one to 12 meters.

S. nigricans practices a form of agriculture with a species of red algae. The fish will claim a patch of "brown carpet algae" which it defends by chasing away other fish and sea urchins. The fish also pulls up other bits of algae that attempt to grow in the patch and swims outside of its territory to spit the invading algae out. When the fish claiming a patch is removed, the patch is eaten up within a few days. When a patch of the brown carpet algae is caged to keep both S. nigricans and other fish out of the patch, other species of algae quickly overwhelm the patch. This seems to indicate the brown carpet algae are dependent on S. nigricans for its survival.[1]

References [edit]

  1. ^ Hata, Hiroki; Kato, Makoto (December 22 2006). "A novel obligate cultivation mutualism between damselfish and Polysiphonia algae". Biology Letters 2 (4): 593–6. doi:10.1098/rsbl.2006.0528. PMC 1833977. PMID 17148297. Retrieved 2007-01-15. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!