Overview

Comprehensive Description

Biology

Occur in outer reef flats and shallow lagoon (Ref. 37816). Reported to be taken in a trawl, thus presumably caught somewhat deeper than 7 m. Also reported to occur in reefs at a depth of about 30 m (Ref. 5213). Because of its small size and apparent rarity, it is of little or no commercial importance.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Natal, South Africa to the central Pacific. Not known from the Red Sea nor Persian Gulf.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

General
Epinephelus melanostigma is an Indo-West Pacific species found from Natal, South Africa to the central Pacific. It is not known from the Red Sea nor Persian Gulf.

Specific
Australia: New South Wales - Lord Howe Is., Cook Islands, Hong Kong, Indonesia: Bali, Java , Lesser Sunda Is., Moluccas , Papua , Sumatra, Japan: Ogasawara-shoto , Ryukyu Is., Kiribati, Madagascar, Maldives, Marshall Islands, Mauritius, Micronesia Federated States of, Mozambique, Northern Mariana Islands, Palau, Papua New Guinea: Bismarck Archipelago, North Solomons, Philippines, Samoa, Seychelles, Solomon Islands, South Africa: KwaZulu-Natal, Taiwan, Province of China ,Tokelau, United States Minor Outlying Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Madagascar, Mauritius, Mozambique, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa, Madagascar and western Mascarenes east to Line Islands and Cook Islands, north to Taiwan, south to Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 16; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 330 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 48635))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A single large black blotch along middle of dorsal fin base (Ref. 37816), which can be turned off (Ref. 48635).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found at depths of less than 7 m. However, it was reported to be taken in a trawl, thus presumably caught somewhat deeper than 7 m. Also reported to occur in reefs at a depth of about 30 m (Ref. 5213). Because of its small size and apparent rarity, it is of little or no commercial importance.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Epinephelus melanostigma
Catalog Number: USNM 115385
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Tutuila Island, Fagasa Bay, rock pools on northwest side of island., Tutuila, American Samoa, Samoa Islands, Pacific
Vessel: Bushnell
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Epinephelus melanostigma
Catalog Number: USNM 148967
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Rose Island., Rose Atoll, American Samoa, Samoa Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Epinephelus melanostigma
Catalog Number: USNM 148966
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Swains Island, reef., Swains Island, American Samoa, Tokelau Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Epinephelus melanostigma
Catalog Number: USNM 115375
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): L. Schultz
Year Collected: 1939
Locality: Swains Island, reef., Swains Island, American Samoa, Tokelau Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Epinephelus melanostigma
Catalog Number: USNM 115376
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Hull Island, channel., Hull Island, Kiribati, Phoenix Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Epinephelus melanostigma
Catalog Number: USNM 148965
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Hull Island, reef., Hull Island, Kiribati, Phoenix Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Epinephelus melanostigma
Catalog Number: USNM 115374
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Canton Island, ocean side reef, lagoon, channel, Canton Island, Kiribati, Phoenix Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Epinephelus melanostigma
Catalog Number: USNM 148968
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Tutuila Island, reef at Alofau, about 11 miles east by road of Pago Pago., Tutuila, American Samoa, Samoa Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 30 m (Ref. 5213)
  • Fischer, W., I. Sousa, C. Silva, A. de Freitas, J.M. Poutiers, W. Schneider, T.C. Borges, J.P. Feral and A. Massinga 1990 Fichas FAO de identificaçao de espécies para actividades de pesca. Guia de campo das espécies comerciais marinhas e de águas salobras de Moçambique. Publicaçao preparada em collaboraçao com o Instituto de Investigaçao Pesquiera de Moçambique, com financiamento do Projecto PNUD/FAO MOZ/86/030 e de NORAD. Roma, FAO. 1990. 424 p. (Ref. 5213)   http://www.fishbase.org/references/FBRefSummary.php?id=5213&speccode=151 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
General
Epinephelus melanostigma is a coral reef-associated species occurring in outer reef flats and shallow lagoons (Myers 1999), reportedly in depths less than 7 m (Heemstra and Randall 1993) although also reported to occur in reefs at a depth of about 30 m (Fischer et al. 1990) and has appeared in trawls (Gloerfelt-Tarp and Kailola 1984). Its maximum size is reported to be 35.0 cm TL (Kuiter and Tonozuka 2001). There are reports of ciguatera poisoning for this species (Dalzell 1991).

Feeding
Feeds on fishes and benthic crustaceans (Masuda and Allen 1993).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 0.15 - 5.5
  Temperature range (°C): 26.886 - 29.336
  Nitrate (umol/L): 0.025 - 0.555
  Salinity (PPS): 34.109 - 34.999
  Oxygen (ml/l): 4.454 - 4.660
  Phosphate (umol/l): 0.111 - 0.282
  Silicate (umol/l): 1.043 - 6.035

Graphical representation

Depth range (m): 0.15 - 5.5

Temperature range (°C): 26.886 - 29.336

Nitrate (umol/L): 0.025 - 0.555

Salinity (PPS): 34.109 - 34.999

Oxygen (ml/l): 4.454 - 4.660

Phosphate (umol/l): 0.111 - 0.282

Silicate (umol/l): 1.043 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated. Reported to be taken in a trawl, thus presumably caught somewhat deeper than 7 m. Also reported to occur in reefs at a depth of about 30 m (Ref. 5213). Because of its small size and apparent rarity, it is of little or no commercial importance.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in the coral reefs of the Indo-Pacific Region (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epinephelus melanostigma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CACCCTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACAGCCCTCAGCCTACTTATTCGAGCTGAGCTGAGCCAACCAGGAGCCCTGCTCGGCGACCACCAGTATTATAACGTAATTGTTACAGCACATGCTTTCGTAAAAATTTTCTTTATAGTAATGCCAATCATGATTGGTGGCTTCGGAAACTGACTTATCCCCCTAATAATCGGTGCCCCAGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTTCTCCCCCCATCTTTCCTGCTTCTTCTAGCCTCTTCTGGAGTAGAAGCTGGTGCTGGTACTGGTTGAACAGTCTACCCGCCCCTAGCTGGAAACCTGGCCCATGCGGGTGCATCTGTAGATTTAACCATCTTCTCATTACACTTGGCAGGTATTTCATCAATTCTAGGAGCAATTAACTTTATCACCACCATCGTCAACATGAAACCCCCCGCCATTTCTCAATACCAGACACCTTTATTTGTATGAGCTGTCCTAATTACAGCAGTACTGCTGCTTCTATCCCTCCCTGTTCTCGCCGCCGGCATTACAATGCTTCTAACAGACCGAAATCTTAATACTACCTTCTTTGACCCAGCCGGAGGGGGAGACCCAATTTTATACCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus melanostigma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Russell, B., Rhodes, K., Myers, R., Heemstra, P.C. & Kulbicki, M.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Epinephelus melanostigma is listed as Data Deficient owing to confusion in records of other serranids in the hexagonatus complex. The species is likely a minor component of both artisinal and live reef food fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Little known about its population or abundance, probably because Epinephelus melanostigma is a member of the reticulated (hexagonatus) grouper complex and easily confused with other species. It is not commonly observed. It constituted less than 2% of catch in reef fish fisheries in Pohnpei in 2006 (Rhodes and Tupper 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Epinephelus melanostigma is found in subsistence fisheries, but because of its small size and apparent rarity, it is of little or no commercial importance. Habitat degradation (coral loss) may also impact this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Epinephelus melanostigma occurs in marine protected areas within its range, but there are no specific measures for the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!