Overview

Brief Summary

Biology

The goliath grouper may be solitary or occur in groups of up to 50 or more individuals. Home range appears limited and the fish produces a booming sound when threatened by divers or large sharks. Variations of these vocalizations also undoubtedly have intraspecific communicative properties (4). During the breeding season from July through September, goliath groupers gather together at breeding sites in groups of 100 individuals or more, for periodic spawning. The fertilised eggs are scattered in the water column of the ocean and develop into kite-shaped larvae with long dorsal fin spines and pelvic fin spines (3) (4). About a month or more after hatching, the larvae mature into juveniles of just 2.5 cm long and settle preferentially into mangrove habitat (3) (4). These fish are very long-lived with a slow growth rate and late sexual maturation. Males begin breeding at four to six years and females mature at six to seven years. However, if goliath grouper are like most other groupers, they may undergo a sex-change part way through life, starting out as a female and becoming males at some later time, but this has never been observed in this species (3). Goliath groupers feed on crustaceans, such as spiny lobsters, shrimps and crabs as well as fish including stingrays and parrotfish, in addition to octopuses and young sea turtles. Despite having teeth, the fish engulfs its prey and swallows it whole. Before the goliath grouper reaches full-size it is susceptible to the attack of barracuda, king mackerel and moray eels, as well as sandbar sharks and hammerhead sharks (3). Once fully grown, humans and large sharks are the goliath grouper's only predator (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The goliath grouper is the largest member of the sea bass family. Its body is large and stocky, measuring half as wide as it is long. The head is broad with small eyes and the pectoral fins and tail fins are rounded. The first and soft dorsal fins are joined together along the back of the fish, and the bases of the first dorsal fin and anal fins are covered with scales and thick skin. Goliath groupers are dull green, grey, or dark yellow to brown, with small dark spots on the head, body and fins. Smaller individuals of less than one metre long are more decorative, with three or four faint vertical bars on their sides. Juveniles are tawny-coloured with dark banding and blotching. This predatory fish has several rows of small teeth in the jaw and small pharyngeal teeth (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: grouper (English), cabrilla (Espanol), mero (Espanol)
 
Epinephelus itajara (Lichtenstein, 1822)


Goliath grouper,     Itajara grouper


Body robust and oblong; wide and flat between eyes; eyes small; edge of preopercle angular; finely serrated; 21-24 gill rakers; dorsal fin XI, 15-16, the spines shorter than the rays; anal rays III, 8; pectoral rays 19; tail rounded.


Large fish:  grey or greenish with pale blotches and smaller dark brown or blackish spots scattered over upper parts of head, body, and on pectoral fins. Small fish  (< 100 cm) greenish to tawny brown with oblique, irregular darker brown bars.

The largest bony reef fish in the region, growing to 250 cm and 320 kg.

Size: 250 cm. Reaches at least 309 kg.

Habitat: rocky reefs as well as bays, estuaries and mangrove areas.

Depth: 1-100 m.

Western and eastern Atlantic and eastern Pacific; the SW and central E Gulf of California to Peru, the Revillagigedos, Cocos and Malpelo.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A solitary species (Ref. 26340) occurring in shallow, inshore areas. Found on rock, coral, or mud bottoms (Ref. 5217). Juveniles found in mangrove areas and brackish estuaries (Ref. 5217). Large adults may be found in estuaries (Ref. 5217). Adults appear to occupy limited home ranges with little inter-reef movement. Feeds primarily on crustaceans, particularly spiny lobsters as well as turtles and fishes, including stingrays. Territorial near it's refuge cave or wreck where it may show a threat display with open mouth and quivering body. Larger individuals have been known to stalk and attempt to eat divers. Over-fished, primarily by spear fishing (Ref. 9710). Marketed fresh and salted. Meat is of excellent quality. Important game fish (Ref. 9342). Reported to reach weights of more than 315 kg (Ref. 26938).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Tropical and subtropical waters of the Atlantic and eastern Pacific oceans. Ranges from Florida to southern Brazil in the western Atlantic and is caught widely in the Gulf of Mexico and most of the Caribbean. Occurs from the Gulf of California to Peru in the eastern Pacific (Beebe and Tee-van 1933, Heemstra and Randall 1993, Greenfield and Thomerson 1997, Hoese and Moore 1998). Also occurs in east Africa from Senegal to the Congo, but reported as EPINEPHELUS ESONUE (Heemstra and Randall 1993). Rare in Aruba, Bonaire, and Curacao, and cited as uncommon in the Lesser Antilles such as Saba, St. Martin, and St. Eustatius (Nagelkerken 1981a, FAO 1993). Specific location records include: Bermuda (Smith 1958), Bahamas (Smith 1971, Roe 1976), Campeche Bank, Mexico (Roe 1976), eastern Gulf of Mexico or west Florida shelf (Tabb and Manning 1961, Smith et al. 1975, Colin 1990), Florida Keys (Starck, 1968; Voss et al. 1969), Cuba (Smith 1971), Jamaica (Thompson and Munro 1983), Hispaniola (Smith 1971), Brazil, and Colombia (Smith 1971). The range in the Atlantic is principally confined to south Florida (Huntsman et al. 1990); spawning aggregations reported only in the eastern Gulf of Mexico (Bullock and Smith 1991, Bullock et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Chesapeake Bay, Virginia and possibly north to Massachusetts, to Brazil, including Bermuda and the West Indies; throughout the Gulf of Mexico.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Epinephelus itajara is found in tropical and subtropical waters of the Atlantic Ocean. In the western Atlantic, the species ranges from North Carolina (USA) to southeast Brazil (Francesconi and Schwartz 2000), and is caught widely in the Gulf of Mexico and throughout most of the Caribbean. It is reported in the eastern Atlantic from Senegal to Congo.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Florida, USA to southern Brazil, including the Gulf of Mexico and the Caribbean. Eastern Atlantic: Senegal to Congo (reported as Epinephelus esonue, Ref. 2739, 6809); rare in Canary Islands (Ref. 6808). Eastern Pacific (Gulf of California to Peru) species refers to Epinephelus quinquefasciatus. Discrete populations of E. itajara exist in the western Atlantic (Ref. 89627).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic [and formerly eastern Pacific].
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The goliath grouper is found in the eastern Atlantic Ocean from Senegal to Congo, but is particularly rare around the Canary Islands, and in the western Atlantic Ocean from Florida to Brazil including the Gulf of Mexico and the Caribbean Sea. They are also found in the eastern Pacific Ocean from the Gulf of California to Peru (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 100 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 16; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 250.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 2500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

250 cm TL (male/unsexed; (Ref. 26550)); max. published weight: 455.0 kg (Ref. 4841); max. reported age: 37 years (Ref. 4841)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Smith (1971): head broad and flat, large species, XI dorsal spines, vertical fins rounded, dorsal spines short, and small black spots.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Head long. Opercle with 3 flat spines, middle one the largest. Pelvic fins smaller than the pectorals. Bases of soft dorsal and anal fins covered with scales and thick skin. Juveniles tawny with irregular vertical bands.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Often found in shallow water; juveniles are common in mangrove swamps and both juveniles and adults occur in bays and harbors. Large adults are also encountered offshore on wrecks and in areas of high relief; they appear to occupy limited home ranges with little inter-reef movement (Heemstra and Randall 1993). Occurs from shallow bays and estuarine areas to offshore; large individuals have been observed in shallow waters of the Everglades, Florida Bay, and the Florida Keys (Bullock and Smith 1991). Inhabits shallow shore zones and is particularly prevalent near mangrove roots (Smith 1971, Thompson and Munro 1983). Habitat also includes shallow water, usually less than 30 m, but also artificial reefs and sunken reefs at 30-35 m depth (Colin 1990). Common nearshore around docks, in deep holes, wrecks, pilings, and cuts (Voss et al. 1969). Larger individuals only occur in places where big holes provide shelter (Nagelkerken 1981b). Characterized as an apex predator in shallow (< 30 m) reef and hard-bottom habitats (Parrish 1987). Juveniles occur in holes and below undercut ledges in swift tidal creeks draining mangroves; also occur in estuaries, especially around oyster bars, as well as mangrove channels (Tabb and Manning 1961, Bullock et al. 1992, Greenfield and Thomerson 1997). Center of abundance along Florida west coast appears to be the 10,000 Islands region near Naples due to extensive habitat (mangroves) for juveniles. Juveniles occur in mangrove areas where currents have undercut ledges or scoured out relatively deep holes (3 m) (Bullock and Smith 1991). Spawning aggregations have been observed during the summer on offshore wrecks at 36-46 m depth in the eastern Gulf of Mexico (Bullock and Smith 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
General Ecology
Found from inshore to about 100 m in reef, mangrove, seagrass, and estuarine habitats (Sadovy and Eklund 1999).

Juveniles live in shallow bays, holes, below undercut ledges in swift tidal creeks draining mangrove swamp, rivers and estuaries while adults live around structures in, near, and offshore (Bullock et al. 1992, Gerber et al. 2005, Koenig et al. 2007). Juveniles exhibit high site fidelity to mangrove habitat for 5-6 years, then emigrate to offshore reefs at body length of about 1 m TL (Koenig et al. 2007).

Juvenile distribution in mangroves depends on local water quality, particularly dissolved oxygen content (>4 ppm) and mid-range salinities (>10 ppt) (www.bio.fsu.edu/coleman_lab/goliath_grouper.html, accessed on 31st Dec 2005).

During a survey of the freshwater fish of southern Florida from 1976 to 1983, no E. itajara was collected although the salinity-tolerant juveniles could be found in shallow, costal waters (Loftus and Kushlan 1987). In 181 sites, presence of mangrove areas appears to be important for juveniles (Sadovy and Eklund 1999). Koenig et al. (2007) demonstrated the high nursery value of mangrove to juveniles.

Diet
The species feeds on a wide diversity of fishes and invertebrates (Sadovy and Eklund 1999). It is a classic apex predator, large, rare and only a few individuals occur on any given reef unit (Huntsman et al. 1999)

Reproduction
Up to 100, sometimes more, individuals aggregate to spawn at specific times and locations. The aggregations last only a few weeks each year and represent most of the total annual reproductive effort (Sadovy and Eklund 1999). Its reproductive season occurs between June and December, with peak activity indicated from July through September in the eastern Gulf of Mexico (Bullock et al. 1992). The species is one of the few groupers that aggregate in relatively shallow (10-50 m) water (Coleman et al. 2002).

Possible courtship activities (without spawning) were observed on a wreck in the eastern Gulf of Mexico at 33 m depth in August 1990 (Colin 1994). Wrecks are often noted to be spawning areas for this species.

A study indicated that a 1,322 mm standard length (SL) and a 1,397 mm SL female had a batch fecundity of 38,922,168 ±1,518,283 and 56,599,306 ±1,866,130 oocytes, respectively (Bullock and Smith 1991).

According to a conceptual model for the role of dispersal in a simple life history model of E. itajara, such groupers exhibit a positive response to the establishment of a marine reserve. Apart from inducing an increase in population growth rate, implementation of a reserve could increase population recovery rates by increasing reproductive output (Gerber et al. 2005).

Age, growth and longevity
Epinephelus itajara grow slowly relative to their potential maximum size. Growth rates for male and female are similar, averaging >100 mm per year through age 6, then slowing to about 30 mm per year by age 15, and finally declining to <10 mm per year after age 25. Von Bertalanffy growth model was found to be TL (mm) = 206[1-e(-0.126(Age+0.49)] (Bullock et al. 1992).

Maximum size and age recorded were 2,000-2,500 mm TL (Heemstra and Randall 1993), 37 years (female) and 26 years (male) (Bullock et al. 1992), respectively.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range ? - 100 m (Ref. 9710), usually ? - 46 m (Ref. 55295)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 12.5 - 174
  Temperature range (°C): 26.990 - 26.990
  Nitrate (umol/L): 1.371 - 1.371
  Salinity (PPS): 36.200 - 36.200
  Oxygen (ml/l): 4.495 - 4.495
  Phosphate (umol/l): 0.101 - 0.101
  Silicate (umol/l): 3.321 - 3.321

Graphical representation

Depth range (m): 12.5 - 174
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 100m.
Recorded at 100 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This marine fish inhabits shallow, inshore waters with mud, rock or coral bottoms and is infrequently found below depths of 46 m. Juveniles inhabit mangroves and associated structures for the first four to six years of their lives, then egress to offshore reefs at about 1 m in length (4). Adults prefer structured habitat, such as rocky ledges, caves, and ship wrecks (1) (3) (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel, Estuary

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Smith (1971): eats mainly crustaceans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in coral reefs, over shallow water. A solitary species (Ref. 26340) occurring in shallow, inshore areas. Found on rock, coral, or mud bottoms (Ref. 5217). Juveniles found in mangrove areas and brackish estuaries (Ref. 5217). Large adults may be found in estuaries (Ref. 5217). Adults appear to occupy limited home ranges with little inter-reef movement. Feeds primarily on crustaceans, particularly spiny lobsters as well as turtles and fishes, including stingrays. Territorial near it's refuge cave or wreck where it may show a threat display with open mouth and quivering body. Larger individuals have been known to stalk and attempt to eat divers. Over-fished, primarily by spear fishing (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes, sharks/rays, sea snakes/mammals/turtles/birds
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Heterotyphlum Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: Exact number of extant occurrences is unknown; may be limited to a few occurrences based upon known spawning aggregation sites in the eastern Gulf of Mexico (Colin 1990, Bullock and Smith 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Global abundance is unknown. Absent, disappearing, or becoming increasingly rare throughout range; especially true for larger individuals (Sobel 1996). The center of abundance is off peninsular Florida; more abundant in south Florida than in northern waters (Caribbean Fisheries Management Council 1993). Historically common in deeper channels in northern Florida Bay, Cape Sable; adults up to more than 400 pounds were taken in the Shark River estuary in the 1960s (Tabb and Manning 1961). Considered historically frequent in the Florida Keys (Starck 1968) but considered less common in the Florida Keys than in the Dry Tortugas (Jones and Thompson 1978). Commonly landed by Cuban Gulf Fleet operating off west Florida during the 1970s (Tashiro and Coleman 1977). Historically, the majority of the U.S. commercial catch was landed along the Gulf coast of Florida; landings were maximal in 1988, with 61,700 kg landed (Bullock et al. 1992). Prior to a moratorium on harvest, commercial landings in Monroe County, Florida, remained relatively stable between 1977 (14,558 kg) and 1989 (11,236 kg). Formerly very abundant in recreational landings; over 104,000 kg landed in 1982 compared to only 16,781 kg landed in 1989 (Bohnsack et al. 1994). Very rare in Aruba, Bonaire, and Curacao; uncommon in St. Martin, St. Eustatius, and Saba (Nagelkerken 1981a). Considered rare in Bermuda (Smith 1958). Also very rare in the central Bahamas; only one large individual (1.5 m) observed at 70 sites surveyed (Sluka et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Individuals tend to be site- or reef-specific, however, tagging studies have shown individuals may move 12 miles or more (Topp 1963).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Transient spawning aggregations (Domeier and Colin 1997) have been observed from July-September in the eastern Gulf of Mexico (Colin 1990, Bullock and Smith 1991, Bullock et al. 1992). May pair-spawn like coney during August-September (Colin 1990). Spawning aggregations may consist of 20-30 large adults (45-200 kg) (Heemstra and Randall 1993). Batch fecundity for two females of 132 and 140 cm SL was 37-40 million and 55-58 million oocytes, respectively. Reproductive ability or maturation is not attained until a very large size: males first mature at 110-115 cm total length (4-6 years of age), while females first mature at 120-135 cm total length (6-7 years of age) (Bullock et al. 1992). Growth averages greater than 100 mm/year until the age of 6 years, when sexual maturity is attained; growth then declines to about 30 mm/year at age 15 (182-191 cm total length) and to less than 10 mm/year after age 25. Extremely long lived, with a lifespan of 30-50 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epinephelus itajara

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGGGCTGGGATAGTAGGAACAGCCCTTAGCCTACTAATTCGGGCTGAGCTAAGCCAGCCAGGGGCTCTACTGGGCGATGACCAGATCTATAATGTAATTGTTACAGCACATGCTTTTGTAATAATCTTTTTCATAGTAATGCCAATCATGATTGGTGGCTTTGGAAATTGACTTGTCCCACTTATAATCGGCGCCCCTGACATAGCATTCCCTMRAATAAATAACATAAGCTTCTGACTTCTCCCCCCTTCTTTCCTGCTTCTTCTTGCCTCTTCGGGGGTAGAAGCTGGTGCCGGTACTGGTTGAACGGTCTACCCGCCCCTAGCCGGAAATTTAGCCCATGCAGGAGCATCCGTAGACTTAACTATTTTCTCACTTCATTTAGCAGGTATCTCATCAATTCTAGGTGCAATTAACTTTATTACAACCATTATTAACATAAAACCCCCTGCCATCTCCCAATACCAAACACCTTTGTTTGTGTGAGCTGTACTAATCACAGCAGTACTACTACTCCTCTCCCTTCCCGTCCTTGCCGCCGGCATCACCATGTTGCTCACTGATCGTAACCTTAACACTACCTTCTTTGACCCAGCCGGAGGAGGAGATCCAATTCTTTACCAGCACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus itajara

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus quinquefasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Relatively wide geographic range in tropical and subtropical waters of the Atlantic and eastern Pacific oceans; greatest abundance occurs off peninsular Florida; significant population declines due to overfishing seem to have occurred throughout range, but principally in the eastern Gulf of Mexico and southeastern U.S.; considered extremely vulnerable to fishing because of life history characteristics; there is little, if any, evidence of recovery of overfished populations; status of populations in the eastern Pacific is unknown.

Other Considerations: Vulnerable to excessive exploitation due to slow growth, delayed reproduction, and aggregate spawning.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2d

Version
3.1

Year Assessed
2011

Assessor/s
Craig, M.T.

Reviewer/s
Sadovy, Y. & Liu, M.

Contributor/s
Chan, T.T. & Padovani-Ferreira, B.

Justification
Epinephelus itajara is a widespread, slow growing, and aggregating species that has undergone significant population reduction over the past three generations (40.5 years) estimated to be at least 80% based on landings data and underwater visual censuses. Although there are now several regulations which prohibit E. itajara from being harvested (e.g., Continental USA since 1990; US Caribbean since 1993; Brazil since 2002), and despite promising signs of recovery in the USA, especially from increased sightings of smaller fish, there is no indication that the threat from overfishing has abated. It is probable that low level harvest of this species continues by poaching and mortality upon release following accidental capture as a result of barotrauma. As a result, high uncertainty is associated with any predictions for recovery of the species.

Despite clear and promising signs of recovery in US waters following the 1990 moratorium, the increases in numbers noted are young and juvenile fish (the species takes five to six years to become sexually mature). Hence many years of protection are still needed to enable populations to recover reproductive potential and range. Continued surveys and education programmes for this species and its inclusion in marine protected areas are proposed.

Because of the factors listed above, this species is listed as Critically Endangered (A2d).

It is recommended that the species be reassessed after five years following the completion of dedicated surveys and stock assessments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The goliath grouper is classified as Critically Endangered (CR A1d +2d) on the IUCN Red List 2003.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Listed, Critically endangered

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 30 to >90%

Comments: Most severely impacted grouper in the western Atlantic; overfishing led to severe reductions in populations (Sadovy 1990). Presently scarce throughout the Gulf of Mexico, U.S. western Atlantic, Puerto Rico, and the U.S. Virgin Islands; no longer abundant in any part of range (Caribbean Fisheries Management Council 1993). Declines in landings led to fishery closures in the state of Florida and U.S. territorial waters in 1990 (Bohnsack et al. 1994). Considered overfished in the Florida Keys based on low spawning potential ratio (Ault et al. 1998). Not common in the Netherlands Antilles (Nagelkerken 1981b). Specimens over 500 pounds were frequently observed while diving offshore of Tampa Bay and other areas of the eastern Gulf of Mexico in the 1950s and 1960s (Springer and Woodburn 1960).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Global or regional abundance of adults is unknown. Abundance is now rare where formerly it was abundant (Sadovy and Eklund 1999). The species, in general, was noted to be uncommon or rare in the mid 1990s, but juveniles appear to be recovering in some parts of its range where fishing moratoria were introduced (e.g., Florida). It is a large, rare and only a few individuals occur on any given reef unit (Huntsman et al. 1999).

Female-to-male sex ratio was 1.75:1 in the eastern Gulf of Mexico from 1977 to 1990 (Bullock et al. 1992).

Distribution densities of juveniles around mangrove islands (22-61 juveniles per km of mangrove shoreline) in the Ten Thousand Islands were found to be higher and less variable than the densities in rivers (0-46 juveniles per km) (Koenig et al. 2007).

Sexual pattern has not been confirmed (Bullock et al. 1992, Sadovy and Eklund 1999).

Most individuals collected from the eastern Gulf of Mexico were between nine and 15 years (with female and male ages overlapping), few exceeded 30 years (Bullock et al. 1992).

Estimated average length and fishing mortality in the exploited stock were found to be 1,161 mm total length (TL) and 0.04 per year in the Florida Keys, respectively (Ault et al. 2005).

Based on the distribution of age classes (Bullock et al. 1992) and a maturity age of six years (Sadovy and Eklund 1999), the generation time for Atlantic Goliath Grouper is estimated at 13.5 years (Note: Generation time is defined here as the mean age of reproductive individuals in a population). Therefore, measures of declines and/or recovery over three generations covers a time span of 40.5 years.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Historically this species was of commercial and recreational importance in the western central Atlantic, but now it is considered the most impacted grouper species in the region (Sadovy 1990). Considered very threatened range-wide, principally from fishing and life history characteristics: slow growth, longevity, low natural mortality, and high vulnerability during spawning aggregations (Bullock et al. 1992, Heemstra and Randall 1993). Fishermen historically exploited spawning aggregations in the Key West area.Considered overfished in the Florida Keys based upon a spawning potential ratio less than 30 percent (Ault et al. 1998). Of minor importance in commercial fisheries off the west coast of Florida, where landings for 1988 totaled 61,700 kg; easily approached and speared by divers, hence they are scarce in areas accessible to divers (Bullock et al. 1992). Caught with hook-and-line, occasionally in traps and trawls. Chief method of harvest in Puerto Rico and the U.S. Virgin Islands is spear fishing (Caribbean Fisheries Management Council 1993). Presently protected in U.S. territorial waters and the U.S. Virgin Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Life history characteristics of E. itajara make this species highly vulnerable to overfishing (Bullock et al. 1992). Epinephelus itajara is of significant commercial and recreational interest. Since the 1970s, landings, mean sizes, and catch per unit effort (CPUE) have fallen sharply in regional fisheries, and growth and recruitment are suspected to be in severe decline in some locations due to overfishing. Loss of critical juvenile habitat (i.e., mangroves) would also threaten this species (Sadovy and Eklund 1999; www.bio.fsu.edu/coleman_lab/goliath_grouper.html, accessed on 31st Dec 2005).

Epinephelus itajara is apparently vulnerable to stresses caused by cold water (Gilmore et al. 1978) or red tide — it was recorded that populations of E. itajara were much reduced during a red tide in 1971 and dead individuals over 45 kg were often observed (Smith 1976). During an outbreak of red tide in Florida in March 2003, eleven large dead Goliath Grouper (sized 305 mm to 2,057 mm) washed up near the Sanibel Island Causeway (www.sefsc.noaa.gov/redtidegrouper.jsp, accessed on 4th Jan 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Critically Endangered (CR) (A2d), IUCN Grouper and Wrasse Specialist Group
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is particularly prone to over-fishing because of its large size, slow growth rate, low reproductive rate and group spawning activity. The fish has excellent quality flesh and has been at risk of spear-fishing for recreation and sport (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: More research on population dynamics and reproductive biology is needed. A greater understanding of reproductive biology would greatly facilitate stock management. There is a need to know (1) whether most annual reproduction occurs at spawning aggregations and (2) the geographic locations and durations of significant aggregations. There is also a need to know how aggregation fishing is likely to affect courtship or spawning behavior. Relatively little is known concerning the minimum size of sexual maturation relative to the size of entry into the fishery. It is also not known to what extent individuals recruit locally or from larvae from up-current and/or off-island locations. Little is known concerning the characteristics of critical juvenile habitat nor of the principal settlement periods (Sadovy 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: The South Atlantic Fishery Management Council administers commercial and recreational fisheries in U.S. territorial waters of the Atlantic. Federal commercial regulations prohibit the possession or harvest of jewfish in or from the Economic Exclusive Zone. Prior to the harvest ban in 1990, a minimum size limit of 13 inches (fork length) was established in Florida waters before 1970. In 1985, the size limit was increased to 18 inches (Huntsman et al. 1990). Harvest ban in U.S. federal waters and state waters of Florida became effective in 1990 because of vulnerability to overfishing and dramatic declines in populations (Bullock et al. 1992, Bohnsack et al. 1994). Because it is rare and easily taken, it is now offered stringent protection in Texas, Louisiana, and Florida, where possession by anglers is prohibited (Hoese and Moore 1998). It is unlawful to harvest, possess, land, purchase, sell or exchange the species in Florida. Also protected from collection in the U.S. Virgin Islands (Caribbean Fisheries Management Council 1993).

Needs: Occurrences should be protected to ensure long-term survival. Stocks should be managed to maintain adequate reproductive (spawning) stock biomass to sustain recruitment. Serious consideration should be given to the protection of spawning aggregations, at a minimum by prohibiting spear guns and fish traps and by permitting only low levels of exploitation at most. The introduction of no-fishing zones in critical areas also needs to be considered as a management option to address the problem of overfishing (Sadovy, in press).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Epinephelus itajara was listed as a candidate species on the US Endangered Species List in 1999 (Federal Register, 23 June 1999) (www.natureserve.org/explorer/servlet/NatureServe?searchName=Epinephelus+itajara accessed on 4th Jan 2006), and since 1991 has been referred to as a Species of Concern throughout its geographic range in US waters and the population off the coast of the southeastern US is listed as a Species of Concern by the NMFS (Federal Register 15 April 2004). All harvesting of the E. itajara in federal waters of the southeastern United States (including the Gulf of Mexico) has been prohibited since 1990 by the South Atlantic Fisheries Management Council and the Gulf of Mexico Fisheries Management Council and in the Caribbean since 1993 by Caribbean Fishery Management Council. However, a recent status review (not a full status review) has had the species removed from this category (M. Nammack, NOAA, pers. comm.).

The NMFS, under the authority of the Magnuson-Stevens Fisheries Conservation and Management Act, lists the E. itajara as overfished in Reports to Congress on the Status of Fisheries (www.sefsc.noaa.gov/redtidegrouper.jsp accessed on 4th Jan 2006, Porch et al. 2003).

The American Fisheries Society classified E. itajara as being conservation dependent. Due to the fish's life history, it is vulnerable to become threatened, but can be kept from threatened status with appropriate protective measures (www.gulfcouncil.org/oldstories/2000-07-20-jewfish-update.htm, accessed on 31st Dec 2005).

Classified as endangered by US Fish and Wildlife Service (USFWS) under the concept of District Population Segments (DPS) but regarded as recovering under Fisheries Management Plan (FMP) (Musick et al. 2000).

A 5-year-protection was granted by the IBAMA (Brazilian Environmental Agency) on 20th September 2002 (www.vidamar.org.br/meros/english/index.php accessed on 3rd Jan 2006).

According to the regulations for E. itajara fishing in Puerto Rico and the US Virgin Islands, fishing in any form for this species is totally prohibited all year around (www.caribbeanfmc.com; accessed on 4th Jan 2006).

It was indicated that the ban on spear-fishing in the upper Florida Keys has significantly and beneficially influenced the average size of groupers, although their populations in this region have not reached stable levels (Sluka and Sullivan 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

During the 1980s there was an observed reduction in numbers within spawning aggregations of the goliath grouper dropping from over 100 individuals per location to less than 10 individuals, and numbers were suspected to have been reduced by 80%. This prompted legislative protection preventing fishing of this species. In the ten years following the implementation of the legislation, numbers of individuals in each spawning aggregation rose to 20 – 40 individuals (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Caribbean Fisheries Management Council (1993): chief method of harvest is spear-fishing in Puerto Rico and the U.S. Virgin Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; gamefish: yes; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Atlantic goliath grouper

The Atlantic goliath grouper or itajara (Epinephelus itajara), is a large saltwater fish of the grouper family found primarily in shallow tropical waters among coral and artificial reefs at depths from 5 to 50 m (16 to 164 ft). Its range includes the Florida Keys, the Bahamas, most of the Caribbean, and practically all of the Brazilian coast. On some occasions, it is caught in New England off Maine and Massachusetts. In the eastern Atlantic Ocean, it occurs from the Congo to Senegal.

Description[edit]

Young Atlantic goliath grouper may live in brackish estuaries, oyster beds, canals, and mangrove swamps, which is unusual behavior among groupers.

Atlantic goliath grouper

They may reach extremely large sizes, growing to lengths of up to 4.87 m (16 ft) and can weigh as much as 360 kg (790 lb). The world record for a hook and line-captured specimen is 309 kg (681 lb), caught off Fernandina Beach, Florida, in 1961.[2] They are usually around 180 kg (400 lb) when mature. Considered of fine food quality, Atlantic goliath grouper were a highly sought-after quarry for fishermen. The grouper's inquisitive and generally fearless nature makes it a relatively easy prey for spear fishermen. They also tend to spawn in large aggregations, returning like clockwork to the same locations, making them particularly vulnerable to mass harvesting.

Until a harvest ban was placed on the species, its population was in rapid decline. The fish is entirely protected from harvest and is recognized as a critically endangered species by the IUCN.[1] The US began protection in 1990, and the Caribbean in 1993. The species' population has been recovering since the ban; with the fish's slow growth rate, however, it will take some time for populations to return to their previous levels.

Goliath grouper eat crustaceans, other fish, octopi, young sea turtles, sharks, and barracudas. It is known to attack divers. It also is known to attack 11 ft lemon sharks.

Reproduction[edit]

Goliath groupers are believed to be protogynous hermaphrodites, which refer to organisms that are born female and at some point in their lifespan change sex to male. Most grouper follow this pattern, but it has not yet been verified for the goliath.[3] In fact, males could be sexually mature at smaller sizes (~1150 mm) and younger ages (4–6 years) than females (~1225 mm and ~6–8 years).[4]

Terminology[edit]

The Atlantic goliath grouper has been referred to as the jewfish, but in 2001 the American Fisheries Society stopped using that term because it was culturally insensitive.[5]

References[edit]

  1. ^ a b Craig, M.T. (2011). "Epinephelus itajara". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 30 March 2014.  Database entry includes a range map and a lengthy justification of why this species is critically endangered
  2. ^ IGFA World Records
  3. ^ "FLMNH Ichthyology Department: Goliath Grouper". Flmnh.ufl.edu. Retrieved 2011-10-31. 
  4. ^ Bullock et al. (1992). Age, Growth, and Reproduction of Jewfish Epinephelus itajara in the Eastern Gulf of Mexico. U.S. Fishery Bulletin 90 (2):243-249. Retrieved August 21, 2014.
  5. ^ Brassfield, Mike (May 24, 2001). "Big fish get a giant name". St. Petersburg Times. Retrieved August 21, 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Also known as mero (Brazil), mero guasa (Colombia), cherne (Peru), guasa (Cuba, Venezuela), and (formerly) jewfish (U.S.).

Smith (1971): considered part of subgenus Promicrops, which was previously considered a genus. Appears to be related to Epinephelus lanceolatus and E. tauvina of the Indo-Pacific. The subgenus is demarcated by a broading and depressing of the head and body. No close relatives in American waters.

DNA data indicate that (1) American Epinephelus species are not monophyletic, (2) Cephalopholis is monophyletic only with the inclusion of the morphologically distinct Paranthias, and (3) Mycteroperca is monophyletic only with the inclusion of the Indo-Pacific Anyperodon leucogrammicus (Craig et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!