Overview

Comprehensive Description

Biology

Found in shallow reefs and rocky bottoms. Usually solitary and territorial. Feed mainly on crabs (Calapa and Mithrax) and other crustaceans (alpheid shrimps and scyllarid lobsters), fishes (labrids and haemulids), and octopus. Some undergo sexual inversion at 28 cm TL; most fish larger than 40 cm are males. Important in terms of numbers caught and total weight of landings in the Caribbean. Easily approached by divers (Ref. 9710). Hermaphrodite species. Excellent food fish (Ref. 26938). Readily caught on hook and line and easily speared (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: North Carolina, USA to Venezuela. The most common species of Epinephelus in the West Indies. Bahamas, Antilles, Central and South American coasts
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

General
Epinephelus guttatus is a western Atlantic species that ranges from North Carolina (USA) to Venezuela. The red hind is the most common species of Epinephelus in the West Indies and also occurs in the Bahamas, Antilles, and the Central and South American coasts. There are a few records for Brazil, but those are not confirmed, and there are no voucher specimens or photographs of this species south of Venezuela (Moura and Menezes 2003).

Specific
Anguilla, Antigua, Bahamas, Barbados, Belize, Bermuda, Cayman Islands, Colombia, Cuba, Dominica, Dominican Republic, Grenada, Guadeloupe, Haiti, Honduras, Jamaica, Martinique, Mexico, Montserrat, Netherland Antilles, Panama, Puerto Rico, Saint Lucia, St. Kitts, St. Vincent, Trinidad and Tobago, Turks and Caicos, British Virgin Islands, U.S. Virgin Islands, USA, and Venezuela (www.fishbase.org, Cervigon 1991, Heemstra and Randall 1993, Smith 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: North Carolina, USA to Paraíba, Brazil (Ref. 57756). The most common species of Epinephelus in the West Indies.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 16; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 5222)); max. published weight: 25.0 kg (Ref. 5217); max. reported age: 17 years (Ref. 3095)
  • Burnett-Herkes, J. 1975 Contribution to the biology of the red hind, Epinephelus guttatus, a commercially important serranid fish from the tropical western Atlantic. University of Miami, Coral Gables, Florida. 154 p. Ph.D. dissertation. (Ref. 3095)
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Scales cycloid except for a ctenoid patch of variable size in the pectoral region. Greenish gray to light brown on the back grading to white ventrally, with numerous well-spaced dull orange-red to brown spots on the head, body and fins. Five faint diagonal bars formed by darker spots on the sides. No saddle-shaped blotch on caudal peduncle or along base of dorsal fin (Ref. 26938); further characterized by having body depth contained 2.7-3.1 times in standard length; head length 2.3-2.4 times in standard length; evenly serrate preopercle, without salient angle; posterior nostril larger than anterior nostril (Ref. 89707).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
General
Epinephelus guttatus is a reef-associated species found in shallow reefs and rocky bottoms. Important in terms of numbers caught and total weight of landings in the Caribbean. Easily approached by divers. Excellent food fish. Readily caught on hook and line and easily speared. Faster growing and shorter-lived than most groupers in the Gulf of Mexico (Potts and Manooch 1995).

Feeding
Feeds mainly on crabs (Calapa and Mithrax) and other crustaceans (alpheid shrimps and scyllarid lobsters), fishes (labrids and haemulids), and octopus.

Reproduction
Red hind are usually solitary but seasonally aggregate to spawn. Some undergo sexual inversion at 28 cm TL; most fish larger than 40 cm are males. Females rest on or close to the bottom, while males patrol around an area that consists of one to five females and defend this territory from other males.

Protogynous hermaphrodite species that produces pelagic eggs and larvae. Eggs hatch in 27 hours in lab (Colin et al. 1987). Females rest on or close to the bottom, while males patrol around an area that consists of one to five females and defend this territory from other males. Form aggregations and reproduce almost exclusively within the aggregation period (Shapiro et al. 1993). Reproduces from December to April in the Caribbean and from May to July in Bermuda.

Known spawning aggregations in Puerto Rico:
1. Bajo de Sico, Mayagüez
2. Abril la Sierra, Cabo Rojo
3. Bajo Tourmaline, Mayagüez
4. El Hoyo, La Mella and La Laja, Lajas
5. Mona Island
6. Grappler Bank, Guayama

Largest fish collected in Puerto Rico, 42 cm TL (Mona Island).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 100 - ? m (Ref. 89707)
  • Craig, M., YJ.S. de Mitcheson and P.C. Heemstra 2011 Groupers of the world: a field and market guide. North America: CRC Press/Taylor and Francis Group. 356 p. (Ref. 89707)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 218 specimens in 1 taxon.
Water temperature and chemistry ranges based on 150 samples.

Environmental ranges
  Depth range (m): 1.1 - 49
  Temperature range (°C): 23.534 - 28.034
  Nitrate (umol/L): 0.161 - 3.153
  Salinity (PPS): 34.984 - 36.613
  Oxygen (ml/l): 4.313 - 4.693
  Phosphate (umol/l): 0.052 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 1.1 - 49

Temperature range (°C): 23.534 - 28.034

Nitrate (umol/L): 0.161 - 3.153

Salinity (PPS): 34.984 - 36.613

Oxygen (ml/l): 4.313 - 4.693

Phosphate (umol/l): 0.052 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 100m.
From 2 to 100 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in shallow reefs and rocky bottoms. Feeds mainly on crabs (Calapa and Mithrax) and other crustaceans (alpheid shrimps and scyllarid lobsters), fishes (labrids and haemulids), and octopus. Carnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Females rest on or close to the bottom, while males patrol around an area that consists of 1 to 5 females and defend this territory from other males. Form aggregation and reproduce almost exclusively within the aggregation period (Ref. 8557).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epinephelus guttatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTGTATTTGGTGCCTGAGCTGGTATAGTAGGAACAGCCCTAAGCCTGCTCATTCGAGCTGAGCTCAGCCAACCAGGGGCACTCCTCGGCGATGATCAGATCTATAATGTAATTGTCACTGCACATGCGTTTGTAATAATTTTTTTTATAGTAATGCCAATTATGATTGGTGGCTTCGGAAACTGGCTCATTCCACTTATAATTGGAGCTCCAGATATAGCTTTCCCTCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCATCTTTTCTGCTTCTCTTAGCTTCGTCTGGAGTTGAAGCCGGTGCTGGTACAGGTTGGACGGTATATCCCCCTTTAGCTGGAAATCTAGCCCATGCGGGTGCATCCGTAGATTTAACTATTTTCTCTTTGCATCTGGCAGGTATTTCATCGATTCTAGGAGCAATTAACTTTATTACAACAATCATTAACATGAAACCTCCCGCCATCTCTCAATATCAAACACCTTTATTTGTATGAGCCGTCTTAATTNCAGCAGTGCTTCTACTCCTATCCCTTCCAGTCCTTGCTGCCGGCATTACAATANTNNTAACAGATCGTAATCTCAATACTACTTTCTTTGACCCAGCTGGAGGAGGAGATCCAATTCTCTATCAACACTTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus guttatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Sadovy, Y., Rocha, L., Choat, J.H., Bertoncini, A.A., Ferreira, B.P. & Craig, M.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Epinephelus guttatus is listed as Least Concern as it is a currently widespread and abundant species, although heavily fished. It may be of conservation concern in the future, especially if its aggregations are not protected effectively.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
General
Epinephelus guttatus is one of the most common species of Epinephelus in the West Indies.

Fisheries-independent data
The primary data comes from the Caribbean Southeast Area Monitoring and Assessment Program (SEAMAP-C), a fisheries-independent sampling program that targets the western insular platform of Puerto Rico and collects data on standardized catch rates and fish sizes throughout the year. Fishery-independent data trends showed annual progressive decreases in average catch per unit effort (CPUE), and average lengths of males and females, in both protected and unprotected areas prior to the enactment of seasonal closures. A small increase in annual average CPUE occurred in both regions soon after the enactment of closures, but was followed by continual low values. Initially there were no significant differences in annual average lengths, by sex, prior to and following the enactment of seasonal closures, but significant increases were observed during 2004 to 2006 (A. Marshak MS thesis).

Follow the link below for:

Table 1: Red Hind Average Catch per Unit Effort and Standard Error per year for the total sampled west coast of Puerto Rico, and the three protected areas.

Table 2: Red Hind Average Catch per Unit Effort and Standard Error per annual spawning period (Dec-Mar) for the total sampled west coast of Puerto Rico, and the three protected areas.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In Puerto Rico (and many other islands across the Caribbean), Epinephelus guttatus is threatened by the destruction of coastal habitats (mainly coral reefs, mangroves, seagrass and lagoon habitats) by dredges, coastal fill projects and the impacts associated with high-density residential and industrial development of the coastline (water pollution, thermal pollution, increased sedimentation, etc.). Commercial and recreational fisheries target Epinephelus guttatus with SCUBA with speargun, hook and line, fish traps and nets. Much effort towards red hind is expanded during the reproductive season of the species (Dec. to Feb.) despite local regulations. Other fishing gear such as traps and nets that do not target red hind may take them incidentally.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC) , IUCN Grouper and Wrasse Specialist Group
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
General
Epinephelus guttatus is present in coral reef protected areas in the Greater Caribbean and Florida and regulated by fisheries in Bermuda and US Caribbean.

Country-specific
In 2004, Puerto Rico’s Department of Natural Resources passed a new fisheries regulation to prohibit the take of Epinephelus guttatus during its spawning season (December 1st to February 28 of each year), throughout the waters of Puerto Rico (up to 9 nautical miles from shore). This eliminated the site specific protection of the known spawning areas that had already been enforced for some time. Outside the 9 nautical miles (EEZ) the federal government (NOAA) has designated a ban on the take of Epinephelus guttatus. The enforcement and implementation of the new regulations has been low (Michelle T. Schärer, pers. comm.).

Spawning aggregations of Epinephelus guttatus are protected in St. Thomas (US Virgin Islands), and there are signs that the species is recovering in this area, including an increase in average size of fishes (Nemeth 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; aquarium: public aquariums; price category: high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!