Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Garfish overwinter west of the British Islands and migrate in the spring to the North Sea. In the summer, they are quite common along the Dutch coast and tidal waters. The Wadden Sea is a nursery for young garfish. Because the eggs of this species remain on the bottom, it is important that there is sufficient current to provide them with oxygen. Garfish hunt in schools upon small free-swimming fish (such as young herring, sprat and lesser sandeel) and zooplankton.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Belone belone ZBK (Linnaeus, 1761)

Aegean Sea : 8400-7 (4 spc.), 10.01.1991 , Söke , beach seine , N. Meriç . Mediterranean Sea : 8400-728 (1 spc.), December 2002 , Iskenderun Bay , trawl , C. Dalyan .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 40-40, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Lives close to the surface and has a migratory pattern similar to the mackerel (Ref. 35388). Feeds on small fishes, particularly clupeids and Engraulis (in the Black Sea). Leaps out of the water when hooked. Oviparous (Ref. 205). Eggs may be found attached to objects in the water by tendrils on the egg's surface (Ref. 205). Utilized fresh and frozen; can be fried, broiled and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Garfish or needlefish are easily recognised by their long thin bodies and long needle like mouths. Adults can reach up to 1 m in length and are mostly silver with a blue to green back, which is a typical counter-shading pattern of pelagic fish. There is a single dorsal and anal fin set away from the head and close to the tail. The garfish is a commercially important species but many people are put off by the garfish's green skeleton. In juveniles, the lower jaw is much longer than the upper jaw but in adults the jaws are almost the same length.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Baltic Sea, North Sea, Eastern Atlantic including Madeira.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black Sea and Sea of Marmara.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic and Mediterranean Sea. Three subspecies were recognized by Collette and Parin (1970, Ref. 34977) Belone belone belone (Linnaeus, 1761) (Northeast Atlantic); Belone belone euxini Günther, 1866 (Black Sea and Sea of Azov); Belone belone acus Risso, 1827 (Mediterranean Sea and adjacent parts of Atlantic Ocean, Madeira, Canary Islands, Azores, and south to Cape Verde (Ref. 50279); subspecies Belone belone gracilis Lowe, 1839 (France to the Canary Islands including the Mediterranean) in Collette & Parin, 1990 (Ref. 5757).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black Sea and Sea of Marmara.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baltic Sea, North Sea, Eastern Atlantic including Madeira.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mediterranean Sea and adjacent Portugal (eastern Atlantic).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 16 - 20; Analsoft rays: 19 - 23
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 900 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 900 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

93.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 1,300 g (Ref. 35388)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Jaw teeth comparatively large and widely spaced. Vertebrae 75-84. Vomerine teeth present at lengths greater than 20 cam. Lower jaw a little longer than upper jaw. Juveniles with greatly elongated jaw, without black posterior dorsal fin lobe.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 312 specimens in 1 taxon.
Water temperature and chemistry ranges based on 170 samples.

Environmental ranges
  Depth range (m): -9 - 237
  Temperature range (°C): 6.946 - 12.243
  Nitrate (umol/L): 1.473 - 12.134
  Salinity (PPS): 33.544 - 35.513
  Oxygen (ml/l): 5.786 - 6.553
  Phosphate (umol/l): 0.345 - 0.826
  Silicate (umol/l): 1.720 - 5.488

Graphical representation

Depth range (m): -9 - 237

Temperature range (°C): 6.946 - 12.243

Nitrate (umol/L): 1.473 - 12.134

Salinity (PPS): 33.544 - 35.513

Oxygen (ml/l): 5.786 - 6.553

Phosphate (umol/l): 0.345 - 0.826

Silicate (umol/l): 1.720 - 5.488
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Garfish are pelagic spending winter offshore and coming into shallow waters during summer. Belone belone will spawn during May and June in seagrass beds and their eggs have long sticky filaments that adhere to seagrass blades. The juveniles stay in shallower waters until they reach sexual maturity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Lepeophtheirus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caligus Infestation 16. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caligus disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Belone belone

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Belone belone

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GCTCTCTTCTGGGTGATGATCAAATTTATAATGTTATCGTCACGGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGCGGTTTTGGAAACTGATTAATCCCCCTAATAATTGGAGCCCCTGATATAGCATTCCCTCGAATAAATAACATAAGTTTTTGATTATTACCACCATCATTCCTCCTTCTTTTAGCATCATCTGGGGTTGAAGCTGGTGCCGGAACCGGATGAACTGTTTACCCCCCTCTAGCTGGTAACTTAGCCCACGCGGGAGCATCCGTTGATTTAACAATTTTTTCTCTTCATCTAGCAGGTATTTCATCAATTTTAGGCGCTATTAATTTTATTACCACTATTATTAATATAAAACCACCTGCAATTTCACAATATCAAACCCCACTATTTGTTTGAGCCGTATTAATTACAGCCGTCCTTCTTCTCTTATCCCTACCCGTCCTAGCTGCTGGAATTACAATACTTCTGACAGACCGAAACCTAAACACTACCTTTTTTGATCCTGCTGGCGGTGGAGATCCTATTCTTTACCAACATTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Garfish

For the large freshwater fish, see gar.

The garfish (Belone belone), or sea needle, is a pelagic, oceanodromous needlefish found in brackish and marine waters of the Eastern Atlantic, the Mediterranean Sea and the Baltic Sea.

Description[edit]

The garfish is a long and slender fish with a laterally-compressed body, and grows to about 50 to 75 centimetres (20 to 30 in) in length. The jaws are elongated and armed with sharp teeth. The pectoral, dorsal and anal fins are situated well back on the body and the latter two are similar in appearance. Positioning the fins so far back gives greater flexibility to the body. The lateral line is set low on the flanks. The colour of the body is bluish green with a silvery grey belly and the bones are green.[1]

Behaviour[edit]

Garfish are Pelagic fish. The fish lives close to the surface and eats small fish, has a migratory pattern similar to that of the mackerel, arriving a short time before the latter to spawn. They move into shallow waters in April and May and spawn in areas with eel grass in May and June. In the autumn they return to the open sea, including the Atlantic west of the British Isles. Garfish are oviparous and the eggs are often found attached to objects in the water by tendrils on the egg's surface.

The garfish is a predator and hunt in the open sea seeking out shoals of small fish such as Atlantic herring, sprats, sand eels and even three-spined sticklebacks. They also feed on free-swimming crustaceans.[1]

Use as food[edit]

Garfish are sometimes caught as bycatch, mainly in fixed nets along the coast in shallow waters. If caught with rod and line they tend to leap out of the water when hooked. Garfish are eaten fried, baked, barbecued or smoked. They have unusual green bones (due to the presence of biliverdin) which discourages many people from eating them, but the green colour is harmless.

Notes[edit]

  1. ^ a b "Garfish: Belone belone". NatureGate. Retrieved 2013-12-16. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!