Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Fairly common species (Ref. 9345) found in the continental shelf (Ref. 11035). Important food fish (Ref. 9345).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: barracuda (English), barracuda (Espanol), picuda (Espanol)
 
Sphyraena ensis Jordan & Gilbert, 1882

Mexican barracuda


Body very elongate, cylindrical at the front; head long with a long pointed snout; large protractile mouth with a distinctly protruding lower jaw; jaws and roof of mouth with many long sharp-edged teeth of unequal sizes; two widely separated dorsal fins (V + I, 9); small pectorals, 13 rays; pelvics I, 5, small, origin under or slightly behind tip of pectoral fins, before first dorsal fin, anal fins small, II, 8, similar to and under 2nd  dorsal; a forked tail, without central lobes; a well-developed, straight lateral line; small smooth scales,  108-116 on lateral line.


Silvery with series of chevron-shaped bars on upper two-thirds of side; tail grey.


Size: grows to about 137 cm.

Habitat: coastal pelagic.
Depth: 0-25 m.

Southern California to the SW and central eastern Gulf of California to Chile, and rarely at Malpelo.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: Mexico to Ecuador.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is present in the eastern Pacific from southern California to the southwestern and central eastern Gulf of California to northern Chile, and is seen rarely at Malpelo.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 25 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continental TEP endemic, 3 provinces (Cortez + Mexican + Panamic) endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 137.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 750 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

127 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 9,520 g (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This pelagic species is fairly common (Sommer 1995); it is found in the continental shelf (CENAIM 1992). According to Cooke (1992), this species may occasionally be found in middle estuaries, mangroves and bar-formed lagoons along the tropical eastern Pacific region. It is usually found in schools. It is found to 25m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1 - 118
  Temperature range (°C): 14.235 - 21.063
  Nitrate (umol/L): 0.133 - 31.396
  Salinity (PPS): 34.249 - 34.888
  Oxygen (ml/l): 0.376 - 5.091
  Phosphate (umol/l): 0.366 - 2.256
  Silicate (umol/l): 3.277 - 23.940

Graphical representation

Depth range (m): 1 - 118

Temperature range (°C): 14.235 - 21.063

Nitrate (umol/L): 0.133 - 31.396

Salinity (PPS): 34.249 - 34.888

Oxygen (ml/l): 0.376 - 5.091

Phosphate (umol/l): 0.366 - 2.256

Silicate (umol/l): 3.277 - 23.940
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Surface, Mid Water, Near Bottom, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyraena ensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACTTACTATTCGGTGCCTGAGCTGGGATAGTAGGAACAGCCTTAAGCCTGCTTATTCGAGCTGAACTAAGCCAACCAGGTTCTCTTCTAGGGGACGACCAAATCTACAATGTAATCGTAACGGCACACGCCTTTGTAATAATCTTTTTTATAGTCATGCCGATCATAATCGGAGGCTTTGGGAACTGACTCATCCCTCTGATGATTGGTGCGCCTGACATAGCATTCCCTCGAATGAATAACATAAGCTTCTGGCTACTTCCTCCCTCTTTCCTCTTACTCCTCTCCTCTTCTGCCGTAGAAGCAGGGGCTGGGACAGGATGAACAGTCTACCCTCCGCTAGCTGGGAACTTAGCCCATGCAGGAGCATCCGTCGACTTAACCATCTTCTCCCTTCATCTGGCAGGGATTTCCTCAATCCTCGGGGCCATCAACTTTATTACCACGATTATTAACATGAAGCCAGCAGCAACCTCGATGTACCAAATCCCGCTATTTGTCTGAGCCGTCCTAATTACTGCTGTCCTTCTGCTCCTTTCGCTTCCCGTACTAGCTGCTGGCATTACAATACTCCTGACGGACCGAAACCTAAACACTGCCTTCTTTGACCCAGCAGGAGGGGGAGACCCGATCTTATACCAACACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphyraena ensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Robertson, R., Collette, B., Molina, H., Guzman-Mora, A.G.

Reviewer/s
Carpenter, K., Polidoro, B., Livingstone, S. (Global Marine Species Assessment Team)

Justification
This species is common and widespread in the tropical eastern Pacific. There are no known threats. This species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a common species in artisanal fisheries in Panama (Sommer 1995). There is no other population information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no known threats for this species.


This species is an important commercial fish in Golfo de Montijo, Panama (Vega 2004). It is an important food fish in Mexico, the USA (Sommer 1995), and Colombia. Most of the Mexican production is frozen for export (Sommer 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures for this species. However, this species' distribution includes a number of Marine Protected Areas in the tropical eastern Pacific region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!