Overview

Comprehensive Description

Biology

An uncommon species found among branching corals of sheltered lagoon reefs (Ref.1607). In small to large aggregations low on the reef. Rarely seen deeper than 10 m (Ref. 48635).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Apogon sealei is distributed from Malaysia to the Solomon Islands, north to the Philippines, Palau, and south to Ashmore Reef, Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Malaysia to the Solomon Islands, north to southern Japan, south to northwestern Australia; Palau in Micronesia.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 8
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 48635))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by pale yellow body color; pair of brown stripes on upper half side of body; middle of caudal fin base with black spot; juvenile with pale grey to yellowish body color, four black stripes, caudal peduncle yellow, black spot at middle of caudal fin base; greatest depth of body 2.6-3.0 in SL (Ref 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Apogon sealei is usually found on coastal fringing reefs or patch reefs to a depth of 25 m. It is often found in pairs or in groups among branching corals such as Acropora.

Individuals shelter in amongst the coral during the day and come out to feed at night on zooplankton and benthic invertebrates. This species demonstrates distinct pairing during courtship. The males mouthbrood the fertilised eggs until hatching is ready to occur. In 2007 this species was recorded in high numbers on highly degraded sites (J. Curtis-Quick pers. comm. 2008).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 25 m (Ref. 37816)
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 18 samples.

Environmental ranges
  Depth range (m): 1 - 88
  Temperature range (°C): 21.088 - 29.325
  Nitrate (umol/L): 0.094 - 8.099
  Salinity (PPS): 32.848 - 35.245
  Oxygen (ml/l): 3.800 - 4.641
  Phosphate (umol/l): 0.055 - 0.678
  Silicate (umol/l): 1.464 - 6.021

Graphical representation

Depth range (m): 1 - 88

Temperature range (°C): 21.088 - 29.325

Nitrate (umol/L): 0.094 - 8.099

Salinity (PPS): 32.848 - 35.245

Oxygen (ml/l): 3.800 - 4.641

Phosphate (umol/l): 0.055 - 0.678

Silicate (umol/l): 1.464 - 6.021
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534).
  • Nguyen, N.T. and V.Q. Nguyen 2006 Biodiversity and living resources of the coral reef fishes in Vietnam marine waters. Science and Technology Publishing House, Hanoi. (Ref. 58534)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apogon sealei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGGGCCGGAATAGTCGGGACAGCACTCAGCCTGCTCATTCGAGCCGAGCTTAGTCAACCCGGGGCCCTTCTCGGCGACGATCAAATTTATAATGTCATCGTCACAGCACACGCATTCGTTATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAATTCCTCTGATGATTGGTGCCCCCGACATGGCATTCCCCCGAATAAATAATATGAGCTTCTGACTCCTTCCTCCCTCATTCCTCCTTCTGCTTGCCTCTTCTGGCGTAGAAGCTGGGGCTGGGACCGGGTGAACCGTCTATCCCCCTCTTGCAGGCAATCTCGCCCACGCAGGGGCCTCCGTCGATTTAACAATTTTTTCCCTTCATCTGGCAGGTGTCTCATCGATTTTAGGAGCAATCAACTTCATTACTACAATTATTAACATGAAACCTCCTGCCATCACACAATACCAAACCCCACTATTTGTGTGAGCAGTTCTTATTACTGCAGTACTCCTTCTACTATCCCTTCCCGTTTTAGCAGCTGGAATTACAATACTACTCACAGACCGAAACCTAAATACAACTTTCTTCGACCCAGCAGGAGGTGGGGACCCAATCCTCTACCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apogon sealei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Gon, O.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Apogon sealei has been assessed as Least Concern. It is likely that in areas this species is undergoing declines in abundance due to factors relating to habitat degradation, however these are likely localised threats, as the reefs within this species' range are not all subject to these threats, and the intensity of threats across sites varies. While this species is harvested for the aquarium trade, this threat is unlikely to occur throughout its entire range. Marine protected areas will afford it some protection from many anthropogenic threats. Further research is needed on the harvest levels of this species and the source of specimens, to ensure it is not being over harvested.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Apogon sealei is a common species throughout most of its range often occurring in large aggregations around coral heads (G.R. Allen pers. comm. 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are a number of threats impacting the habitat of this species such as coastal development, tourism, Crown of Thorns starfish invasions, cyanide fishing, water pollution, and coral bleaching. However, this species is known from a number of unimpacted locations throughout the Western Pacific and so threats are only thought to be causing localised declines. This species is harvested for the aquarium trade although it is not believed to be harvested in a significant quantity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures for Apogon sealei, however the distribution of this species may fall within numerous marine protected areas including the Great Barrier Reef Marine Park

Further research is needed on the harvest levels of this species for the aquarium trade, and whether it is captive bred or wild caught.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ostorhinchus sealei

Ostorhinchus sealei is a nocturnal fish that lives in fringing reefs or patch reefs from Malaysia to the Solomon Islands, north to the Philippines, Palau, and south to Ashmore Reef, Australia. This fish is often found in pairs and small groups.

Information[edit]

  • Diet: zoo plankton, small fishes, zoobenthos, benth crustaceans, mobile invertebrates
  • Captivity Diet: small fishes, shrimps, fresh and frozen meaty foods. Training them to accept frozen processed foods is fine, but do not feed your fish flakes, pellets or other dry prepared foods.
  • Depth Range: 1-88m
  • Threats: coastal development, tourism, Crown of Thorns starfish, cyanide fishing, water pollution, coral bleaching
  • Maximum Size: 3.9 inch, 10 cm
  • Threat To Humans: Harmless
  • Temperature range (°C): 21.088 - 29.325
  • Nitrate (μmol/L): 0.094 - 8.099
  • Salinity (PPS): 32.848
  • Aquarium Occurrence: Uncommon-Rare
  • Common Length: 7.7cm
  • Minimum Tank Size: 76 Liters

References[edit]

  • [1] ICUN Redlists's Information
  • [2] Eol's Information
  • [3] Searchfish's Information
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!