Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Comprehensive Description

Biology

Raised commercially in Florida, U.S.A.
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to Rio Ameca basin, western Mexico. Reported multiple times in the 1980s from Rogers Spring in Nevada, but not known to be established there (Fuller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Río Ameca basin, Pacific Slope of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Jalisco, Mexico.
  • Wischnath, L. 1993 Atlas of livebearers of the world. T.F.H. Publications, Inc., United States of America. 336 p. (Ref. 26130)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 80 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 2060)); 12 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 2m.
Recorded at 2 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; pH range: 6.0 - 8.0; dH range: 9 - 19; depth range ? - 2 m (Ref. 26130)
  • Wischnath, L. 1993 Atlas of livebearers of the world. T.F.H. Publications, Inc., United States of America. 336 p. (Ref. 26130)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ameca splendens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TATTTAGTATTTGGTGCCTGAGCCGGTATAGTTGGCACCGCCCTAAGCCTCCTTATCCGAGCTGAATTAAGTCAGCCGGGCTCTCTCTTGGGTGAT---GATCAAATTTATAACGTAATTGTGACAGCTCATGCTTTCGTCATAATCTTTTTTATAGTAATACCAATCATAATCGGTGGTTTCGGCAACTGGCTAGTTCCCCTCATGATTGGAGCTCCAGATATGGCTTTCCCCCGAATGAACAATATAAGCTTCTGACTTCTCCCCCCGTCATTCCTCTTACTCCTAGCATCTTCTGGGGTCGAAGCAGGTGCCGGGACCGGTTGAACTGTTTACCCTCCATTGGCTAGCAACCTAGCCCATGCAGGAGCCTCCGTAGACTTAACCATCTTTTCTCTACATTTAGCAGGGGTATCCTCTATTCTAGGGGCTATTAATTTTATCACTACAATTATTAATATGAAGCCTCCAGCAACTTCACAATACCAGACCCCCTTGTTTGTATGGGCTGTTTTAATTACAGCTGTCCTTCTTCTTCTTTCTCTCCCAGTCTTAGCCGCTGGAATCACCATACTTCTTACTGATCGTAATCTAAACACTACCTTCTTTGACCCAGCAGGGGGTGGTGAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ameca splendens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EW
Extinct in the Wild

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Contreras-Balderas, S. & Almada-Villela, P.

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Extinct in the Wild (EW)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ameca splendens

The butterfly splitfin or butterfly goodeid, Ameca splendens, is a bony fish from the monotypic genus Ameca[2] of the splitfin family (Goodeidae). It was formerly found throughout the Ameca River drainage in Mexico; the type locality is Rio Teuchitlán in the vicinity of Teuchitlán, Jalisco. The species was only ever found in an area about 10 miles (15 km) in diameter.[3]

Today, the species is rated as extinct in the wild by the IUCN, though this assessment is obsolete:[4] a remnant population has been found to persist in El Rincón waterpark near the town of Ameca. Possibly, it also exists in a feral state in the USA; individuals apparently derived from escaped or introduced captive stock were met with in southeastern Nevada.[5] For some time, it was a popular fish among aquarists, but hobbyist stocks have declined recently, placing its survival in jeopardy.[6]

Description[edit]

Female (above) being courted by a young male

As its common name implies, it is indeed quite an attractive fish. A dominant mature male specimen a large dorsal fin which like the caudal fin is washed with black. A yellow band stretches along the caudal's back margin. The body of both sexes is ochre, with silvery sides and a brownish back, which in males usually have numerous glittering metallic scales. Females and immatures having black dots on the sides and ochre fins. The fins of males intensify in color when they are excited, and depending on their mood, they can show more or less strongly a black band along the side. For the first two weeks or so after birth, the young are entirely silvery.[7]

Males can also be told apart from females because their anal fin's front part splits off and transforms to a blunt, flexible andropodium used for mating. As usual in live-bearers, males are the smaller sex, reaching some 3 in (7–8 cm) total length at best, with females being able to grow up to 4 in (10 cm) under good conditions.[7]

Ecology[edit]

In its former natural habitat, the bedrock is limestone, resulting in a hard and alkaline water with a general hardness of 6-10 dGH, while the temporary (carbonate) hardness is usually between 7 and 11°. The pH is around 8, and temperature varies little between the seasons, but ranges between about 70 and 85°F (20 and 30°C) between day and night. The vegetation is largely limited to algae and Ceratophyllum hornworts. The remnant wild population coexists with the native blackfin goodea (Goodea atripinnis) and Lerma live-bearer (Poeciliopsis infans), as well as with the common molly (Poecilia sphenops), Oreochromis tilapias, and the bluegill (Lepomis macrochirus) which presumably have all been introduced.[8]

Among groups of A. splendens, a loose dominance hierarchy develops, in particular in confined environments. Males chase each other about, with the dominant male(s) showing the most splendid coloration. Submissive males will try to retreat from attacks, typically towards the surface, and may shake their head as a calming signal.[6]

Like other Goodeidae, butterfly splitfins mate by internal fertilization and spawn fully developed young. The females become sexually mature at about six months of age and can give birth every six to 10 weeks according to the water temperature and the condition of the fish. Mating is preceded by a courtship, where the males present themselves to the females with their heads pointing downwards – up to 45° from horizontal – and shake the forward part of their bodies. In that respect, they resemble the jeweled splitfin (Xenotoca variata); they do not have a ritualized "courtship dance" as some other splitfins, but the male sometimes rotates to present either flank to the female. The females respond by shaking their heads.[6]

The fry when born can be up to 0.8 in (20 mm) in length, as the females feed the unborn young via trophotaenia which have a similar function as the umbilical cord in humans.[9]

As a pet[edit]

The butterfly splitfin has a reputation of being a fin nipper, but being a large and robust fish, it will certainly bully small and delicate species like guppies or small tetras. When housed with less tender species that require similar conditions, it is a great fish for any tank type; even the hardier species of Apistogramma and similar dwarf cichlids make good companions, with water parameters compromising between the splitfins' and the cichlids' requirements at a point similar to most tap water.[9]

A. splendens thrives best in clean, well-aerated water, at temperatures around 70-75°F (20-25°C) and neutral or slightly higher pH, with water hardness between 5 and 10 dGH composed mainly from calcium hardness. They do not tolerate overly low pH and too soft water, and are unsuitable for dedicated rainforest aquaria with low pH and almost-zero hardness (e.g. for most tetras or danionins). Butterfly splitfins are strong swimmers and social fish; they dwell in groups of three to five males and three to seven females in large tanks where they can grow to full size. In small tanks, they stay small, and fewer individuals or no other fish should be kept. Their overall effect on plant growth is beneficial as they keep down algae and clean off detritus. A. splendens breeds quite readily in the aquarium; some floating plants such as Ceratopteris or Ceratophyllum provide protection for young fry.

Aggressiveness varies with population density; at high population densities, tank decoration is highly significant in influencing behavior. At least among captive populations, butterfly splitfins become more aggressive if much decoration is placed in the tank.[6]

Butterfly splitfins are voracious, and eat most forms of commercial fish food.[9] They take live prey up to the size of week-old guppy fry, but need plant material, ideally green algae, to thrive. They are ideal algae eaters for tanks with small, hard-water cichlids. If not enough algae are available, vegetables such as lettuce, spinach, or green peas are recommended additions to the diet. Fry do not need "baby" food such as brine shrimp or nauplia, though as in adults, plant food increase growth and vitality.[9]

Lighting should be strong, to encourage growth of algae; direct sunlight is ideal. In summer, they can be kept in outside tanks, basins, or small ponds in temperate and warmer areas; they can tolerate overnight air temperatures of 60°F (15 °C) well enough, but should be protected from birds, cats, and other predators.

References[edit]

  1. ^ Contreras-Balderas, S. & Almada-Villela, P. (2008). Ameca splendens. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 24 March 2010.
  2. ^ Etymology:
    "The generic name Ameca is from the name of the river to [the basin of] which the new genus is evidently confined. The gender is feminine."
    "The specific epithet, of Latin derivation, means bright (shining) or glowing, in reference to the striking life colors of the new species."
    (Miller & Fitzsimons, 1971)
  3. ^ Miller & Fitzsimons (1971), Kelley et al. (2006)
  4. ^ Contreras-Balderas & Almada-Villela (1996)
  5. ^ Fuller (2006)
  6. ^ a b c d Kelley et al. (2006)
  7. ^ a b Miller & Fitzsimons (1971), Tavares [2005]
  8. ^ Tavares [2005], Kelley et al. (2006)
  9. ^ a b c d Tavares [2005]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!