Overview

Comprehensive Description

Biology

Inhabits sandy and rocky pools and runs of clear to turbid creeks and small to medium rivers (Ref. 5723, 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) This species is represented by two disjunct populations, east and west of the Mississippi River. (1) Direct tributaries of the Mississippi River and eastern tributaries of the lower Tennessee River, in the Former Mississippi Embayment of western Kentucky, Tennessee, Mississippi, and eastern Louisiana. (2) Arkansas River drainage, eastern Kansas, eastern Oklahoma, southwestern Missouri, and northwestern Arkansas (Page and Burr 2011). The type locality (Ft. Lyon, Colorado) is suspect, and records from the Osage River system and White River are thought to be erroneous (Mayden 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is represented by two disjunct populations, east and west of the Mississippi River. (1) Direct tributaries of the Mississippi River and eastern tributaries of the lower Tennessee River, in the Former Mississippi Embayment of western Kentucky, Tennessee, Mississippi, and eastern Louisiana. (2) Arkansas River drainage, eastern Kansas, eastern Oklahoma, southwestern Missouri, and northwestern Arkansas (Page and Burr 2011). The type locality (Ft. Lyon, Colorado) is suspect, and records from the Osage River system and White River are thought to be erroneous (Mayden 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: tributaries of Mississippi and Tennessee rivers on Former Mississippi Embayment of Kentucky, Tennessee, Mississippi and eastern Louisiana in USA; Arkansas River drainage in southwestern Missouri, eastern Kansas, northwestern Arkansas and eastern Oklahoma, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 7 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 110 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 10294))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Lectotype; Lectotype for Cliola camura
Catalog Number: USNM 15256
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Locality: Ft. Lyon. Colo. T., Colorado, United States, North America
  • Lectotype: Gibbs, R. H. 1961. The American Midland Naturalist. 66 (2): 345.; Jordan, D. S. & Meek, S. E. 1884. Proceedings of the United States National Museum. 7 (450): 474.; : Gibbs, R. H. 1961. The American Midland Naturalist. 66 (2): 345.; Jordan, D. S. & Meek, S. E. 1884. Proceedings of the United States National Museum. 7 (450): 474.; Lectotype: Jordan, D. S. & Meek, S. E. 1884. Proceedings of the United States National Museum. 7 (450): 474.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes sandy and rocky pools and runs of clear to turbid creeks and small to medium rivers (Pages and Burr 2011); Eastern populations may occur over sand; in west, typically over gravel or rubble (Mayden 1989). Generally this shiner does not occur in low gradient habitats. Adults generally are in fast riffles and raceways; young typically are in or close to these habitats but also in shallow pools (Mayden 1989). Eggs are deposited in crevices.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes sandy and rocky pools and runs of clear to turbid creeks and small to medium rivers (Pages and Burr 2011); Eastern populations may occur over sand; in west, typically over gravel or rubble (Mayden 1989). Generally this shiner does not occur in low gradient habitats. Adults generally are in fast riffles and raceways; young typically are in or close to these habitats but also in shallow pools (Mayden 1989). Eggs are deposited in crevices.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arkansas River Benthopelagic Habitat

This taxon is one of a several benthopelagic species in the Arkansas River system. Benthopelagic river fish are found near the river bottom, feeding on benthos and zooplankton.The Arkansas River rises near Leadville, Colorado at an elevation of approximately 3010 meters about thirty kilometers north of Mount Elbert, Colorado's highest peak.

Tthe upper reaches of the Arkansas River manifest turbulent high gradient passage through rugged volcanic terrain; the flow continues to the Royal Gorge, where one of the world's highest suspension bridges towers 320 meters above the river surface; thereafter, the river course flows generally eastward through Kansas, thence southeastward through Oklahoma and Arkansas until its discharge to the Mississippi River. The river basin also includes parts of the states of New Mexico, Texas and Missouri.

Chief tributaries of the Arkansas River are Purgatoire River, Fountain Creek, Pawnee River, Salt Fork River, Illinois River,Verdigris River, Neosho River, Cimarron River and the Canadian River. The mean annual discharge at Little Rock, Arkansas is approximately 1118 cubic meters per second, a level remarkably undifferentiated from virgin flow, before the era of locks, impoundments and extraction.

Water quality at the headwaters near Leadville, Colorado is quite high, consisting of cold, rapidly flowing water of pH 6.3. Concentrations of calcium, sodium, magnesium and chloride are all less than ten milligrams per liter in this pristine headwaters area.

Crossing the Southern Plains below Great Bend, Kansas, the pH elevates to a level of 8.0, sodium concentrations rise to a range of 300 to 500 mg/l, with other ions rising by similar large percentages. After receiving the more pristine runoff from the Ozark Plateau, below Fort Smith, Arkansas, the pH level can be measured as low as 7.5, and sodium along with other ion concentrations are reduced by a factor of four. At the Mississippi Embayment, nitrate and phosphate levels are elevated due to row crop agricultural runoff of this region.

There are 141 species of fish present in the Arkansas basin, including two near endemic benthopelagic species: slough darter (Etheostoma gracile) and speckled darter (Etheostoma stigmae). The federally threatened and near-endemic Neosho madtom (Noturus placidus) occurs in the Neosho River, a tributary that rises in the Flint Hills. Also present in the Neosho River is the endangered Topeka shiner (Notropis topeka). The cardinal shiner (Luxilus cardinalis) is a near-endemic that is now restricted to populations in the Arkansas River and Red River, and disjunctive populations in the Neosho River.

In the upper Arkansas River mainstem a number of reptiles are found in the upper basin, including yellow mud turtle (Kinosternon flavescens), midland smooth softshell (Apalone mutica), western spiny softshell turtle (Apalone spinifera hartwegi) and northern water snake (Nerodia sipedon). In the downriver portions of the basin (Eastern Oklahoma and Arkansas) are found the false map turtle (Graptemys pseudogeographica) and the venomous cottonmouth (Agkistrodon piscivorus).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but apparently quite large (likely greater than 100,000). This fish is generally common; abundant in western Tennessee and in the Neosho River system in Missouri and Oklahoma (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns late spring and early summer (usually early June to mid-July) in Kansas/Missouri, at temperature of at least 25 C. In Kansas, lives up to 2-3 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyprinella camura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCTTTAAGCCTCCTTATTCGAGCTGAATTAAGCCAGCCTGGATCACTCCTAGGTGATGACCAGATCTACAATGTTATTGTTACTGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTCTTATCGGTGGATTTGGAAATTGACTTGTACCTCTAATGATTGGGGCACCTGATATAGCATTTCCACGAATAAATAACATAAGCTTCTGGCTCTTGCCCCCATCATTCCTTCTACTGTTAGCTTCCTCTGGTGTTGAAGCTGGGGCTGGAACAGGATGAACTGTGTATCCTCCACTTGCAGGTAATCTTGCCCACGCGGGAGCATCAGTCGACCTCACAATTTTCTCCCTACACCTAGCAGGTGTATCTTCAATTCTAGGCGCAGTTAATTTCATTACTACTATCATTAACATGAAACCCCCAGCAATCTCTCAATATCAGACACCACTCTTCGTTTGAGCCGTACTTGTAACTGCCGTCCTTCTACTTCTCTCACTACCCGTTTTAGCTGCCGGAATTACTATACTTCTCACTGACCGCAACTTAAACACCACGTTCTTCGACCCAGCAGGCGGAGGTGACCCAATTCTGTATCAACANNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cyprinella camura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations and locations, and large population size, and because the species probably is not declining fast enough to qualify for any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but apparently quite large (likely greater than 100,000). This fish is generally common; abundant in western Tennessee and in the Neosho River system in Missouri and Oklahoma (Page and Burr 1991).

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Removed from genus NOTROPIS and placed in genus (formerly subgenus) CYPRINELLA by Mayden (1989); this change was adopted in the 1991 AFS checklist (Robins et al. 1991). The two disjunct populations may warrant recognition as separate subspecies or species (Gibbs 1961, Mayden 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!