Overview

Comprehensive Description

Biology

Occurs in quiet backwaters and pool margins of small to large rivers. Usually found near vegetation over sand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Confined to the lower Columbia River drainage and tributaries downstream from the mouth of the Clearwater River, Nez Perce County, Idaho (Lee et al. 1980); western Idaho, southern Washington, and northern and western Oregon; uncommon (Page and Burr 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: Columbia River drainage in Idaho, Washington and Oregon, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Confined to the lower Columbia River drainage and tributaries downstream from the mouth of the Clearwater River, Nez Perce County, Idaho (Lee et al. 1980); western Idaho, southern Washington, and northern and western Oregon; uncommon (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 96 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

9.6 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 6 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 8 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paralectotype; Syntype for Percopsis transmontana
Catalog Number: USNM 44874
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): C. Eigenmann
Year Collected: 1892
Locality: Oregon: Columbia River Umatilla, Umatilla County, Oregon, United States, North America
  • Paralectotype: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3259, 330.; Eigenmann, C. H. & Eigenmann, C. H. 1892. Science. 20 (507): 234.; Syntype: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3259, 330.; Eigenmann, C. H. & Eigenmann, C. H. 1892. Science. 20 (507): 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype; Syntype for Percopsis transmontana
Catalog Number: USNM 125635
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): C. Eigenmann
Year Collected: 1892
Locality: Oregon: Columbia River Umatilla, Umatilla County, Oregon, United States, North America
  • Lectotype: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3259, 330.; Eigenmann, C. H. & Eigenmann, C. H. 1892. Science. 20 (507): 234.; Syntype: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3259, 330.; Eigenmann, C. H. & Eigenmann, C. H. 1892. Science. 20 (507): 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Syntype for Percopsis transmontana
Catalog Number: USNM 371921
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): C. Eigenmann
Year Collected: 1892
Locality: Oregon: Columbia River Umatilla, Umatilla County, Oregon, United States, North America
  • Paralectotype: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3259, 330.; Eigenmann, C. H. & Eigenmann, C. H. 1892. Science. 20 (507): 234.; Syntype: Jordan, D. S. & Evermann, B. W. 1900. Bulletin of the United States National Museum. No. 47: 3259, 330.; Eigenmann, C. H. & Eigenmann, C. H. 1892. Science. 20 (507): 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Columbia River Demersal Habitat

This taxon is one of a number of demersal species in the Columbia River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The Columbia River Basin of northwestern North America is an important habitat for Acipenser transmontanus. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The hydrology and aquatic habitat of the Columbia River basin has been adversely altered by numerous large dams. There are over 250 reservoirs and around 150 hydroelectric projects in the basin, including 18 mainstem dams on the Columbia and its main tributary, the Snake River.

Water quality in the Columbia River has deteriorated over the last century, due to agricultural runoff and logging practices, as well as water diversions that tend to concentrate pollutants in the reduced water volume. For example nitrate levels in the Columbia generally tripled in the period from the mid 1960s to the mid 1980s, increasing from a typical level of one to three milligrams per liter. Considerable loading of herbicides and pesticides also has occurred over the last 70 years, chiefly due to agricultural land conversion and emphasis upon maximizing crop yields.

Heavy metal concentrations in sediment and in fish tissue had become an issue in the latter half of the twentieth century; however, considerable progress has been made beginning in the 1980s with implementation of provisions of the U.S.Clean Water Act, involving attention to smelter and paper mill discharges along the Columbia.

Some large demersal fish species occurring in the Columbia Basin are the 610 centimeter (cm) white sturgeon (Acipenser transmontanus), the 76 cm Pacific lamprey (Lampetra tridentata); the 55 cm Brown bullhead (Ameiurus nebolosus); the 61 cm largescale sucker (Catostomus macrocheilus); the 64 cm longnose sucker (Catostomus catostomus catostomus); and the 65 cm Utah sucker (Catostomus ardens).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Small to large rivers. Inhabits slow moving portions of fluvial waters with mud-sand, rock and sand, or vegetated rubble substrate. Often found near undercut banks (Lee et al. 1980). Usually near vegetation over sand (Page and Burr 1991).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Small to large rivers. Inhabits slow moving portions of fluvial waters with mud-sand, rock and sand, or vegetated rubble substrate. Often found near undercut banks (Lee et al. 1980). Usually near vegetation over sand (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May move to shallow streams or to shallow shores of rivers to spawn.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Not well known. Feeds on small insect larvae. Probably also consumes crustaceans and plankton.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Sexually mature at 1 or 2 years. Spawning occurs in late May or early June in Idaho (Simpson and Wallace 1982). One female contained 4,748 eggs (Wydoski and Whitney 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Percopsis transmontana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTCTCAACCAACCACAAAGACATCGGCACCCTCTACTTAGTTTTCGGTGCCTGAGCCGGCATAGTCGGCACAGCCCTGAGTCTGCTGATTCGGGCCGAGCTCAGCCAACCCGGAGCCCTTCTGGGAGAC---GACCAAATTTATAATGTAGTCGTCACAGCACACGCCTTCGTAATAATCTTCTTCATAGTTATACCCATTATGATTGGAGGCTTTGGCAACTGATTGGTCCCCCTAATAATTGGCGCCCCCGACATGGCATTCCCCCGAATGAACAACATAAGCTTCTGACTCCTGCCCCCTTCCTTCCTCCTCCTACTAGCCTCATCGGGCGTAGAAGCAGGAGCAGGTACGGGGTGAACCGTCTACCCTCCCCTGGCAGGGAACCTTGCCCATGCGGGAGCCTCCGTTGATCTCACAATTTTCTCCTTACACCTTGCAGGAGCCTCCTCTATCCTCGGAGCTGTAAATTTTATCACAACAATTATTAACATGAAACCTCCCGCAATTTCTCAATACCAAACACCCCTGTTTGTGTGATCCGTACTAATTACCGCCGTACTGCTGCTCTTGTCCCTTCCTGTTCTTGCAGCAGGGATTACAATGCTTCTCACAGACCGAAACCTAAATACAACCTTCTTCGACCCCGCAGGAGGAGGGGACCCAATTCTTTACCAACACCTTTTCTGGTTCTTCGGACACCCCGAAGTATACATTCTTATTCTCCCGGGCTTCGGAATAATCTCCCACATCGTTGCCTACTACTCAGGAAAAAAAGAACCCTTTGGCTACATAGGCATAGTATGGGCAATAATGGCCATCGGGCTCCTTGGGTTTATTGTTTGAGCCCACCACATATTCACCGTGGGCATGGATGTGGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Percopsis transmontana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Probably an important forage fish for smallmouth bass.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Percopsis transmontana

Percopsis transmontana, the Sand roller, is a species of percopsiform fish endemic to the Columbia River drainage in the northwestern United States. This species grows to a length of 9.6 centimetres (3.8 in) TL. Sand rollers can live up to 6 years in slow-moving, sandy-bottomed streams and rivers among vegetation. Their diet includes flies and Trichoptera, although juveniles also have been known to eat crustacean zooplankton.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Originally described and long recognized in genus COLUMBIA, which has been merged with Percopsis (Lee et al. 1980). One of two species in the genus and family.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!