Overview

Comprehensive Description

Biology

Occurs in lakes, deep flowing pools of creeks, and rivers (Ref. 5723). Usually found over sand (Ref. 5723). Moves into the shallows of lakes at night to feed and moves back to deeper water as dawn approaches (Ref. 1998). Feeds on insect larvae, amphipods and fishes (Ref. 1998). Important forage fish (Ref. 1998).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Atlantic and Arctic basins throughout most of Canada from Quebec to Yukon and British Columbia and south to the Potomac River drainage, Virginia; Yukon River drainage, Yukon and Alaska; Great Lakes and Mississippi River basins south to West Virginia, eastern Kentucky, southern Illinois, central Missouri, North Dakota, and northern Montana; locally common in lakes, uncommon throughout most of range (Page and Burr 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Atlantic and Arctic basins throughout most of Canada from Quebec to Yukon and British Columbia and south to the Potomac River drainage, Virginia; Yukon River drainage, Yukon and Alaska; Great Lakes and Mississippi River basins south to West Virginia, eastern Kentucky, southern Illinois, central Missouri, North Dakota, and northern Montana; locally common in lakes, uncommon throughout most of range (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Atlantic and Arctic basins throughout most of Canada, and south to Potomac River drainage in Virginia, USA; Yukon River drainage in Yukon Territory and Alaska; Great Lakes and Mississippi River basins south to West Virginia, Kentucky, Illinois, Missouri, North Dakota and Montana in the USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Alaska, through much of Canada, and northcentral and northeastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1 - 3; Dorsal soft rays (total): 9 - 11; Analspines: 1; Analsoft rays: 5 - 9; Vertebrae: 33 - 36
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 4 years (Ref. 10348)
  • Magnuson, J.L. and L.L. Smith 1963 Some phases of the life history of the trout-perch. Ecology 44(1):83-95. (Ref. 10348)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished by the presence of an adipose fin; small weak spines in the dorsal and anal spines; rough ctenoid scales; and pectoral fins reaching well behind the bases of pelvic fins (Ref. 27547). Gill rakers short, stubby mounds with small teeth; lateral line nearly straight (Ref. 27547). Pale yellowish to silvery, often almost transparent; with a row of about 10 dark spots along midline of back, 10 or 11 spots along lateral line, and another row of spots high on sides above lateral line; fins transparent (Ref. 27547).
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Typically in lakes but also in deep flowing pools of creeks and small to large rivers; usually over sand (Page and Burr 1991). Normally in deep waters by day, moves into shallows at night (Becker 1983). Spawns in shallow rocky or gravelly streams or over sand or gravel bars or among rocks in lakes. Often spawns in streams in spring and returns to lake after spawning.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Typically in lakes but also in deep flowing pools of creeks and small to large rivers; usually over sand (Page and Burr 1991). Normally in deep waters by day, moves into shallows at night (Becker 1983). Spawns in shallow rocky or gravelly streams or over sand or gravel bars or among rocks in lakes. Often spawns in streams in spring and returns to lake after spawning.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; depth range 10 - 61 m (Ref. 27547)
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 64 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.075 - 15

Graphical representation

Depth range (m): 0.075 - 15
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 61m.
From 10 to 61 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May migrate between lake and spawning stream (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in lakes, deep flowing pools of creeks, and rivers (Ref. 5723). Usually found over sand (Ref. 5723). Moves into the shallows of lakes at night to feed and moves back to deeper water as dawn approaches (Ref. 1998). Feeds on insect larvae, amphipods and fishes (Ref. 1998).
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Young feed on zooplankton to greater extent than do larger fishes, which feed on insects, crustaceans, and other invertebrates, mainly benthic species. Larger individuals may feed on fishes in winter (Scott and Crossman 1973, Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 1,000,000. The species is relatively abundant within its range in Canada and the lower 48 states (Mecklenburg et al. 2002). In Heming Lake, Manitoba, the adult fish population was estimated at 2,929 to 3,636 fish per hectare (Morrow 1980)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawning adults move inshore to shallow water or into shallow tributaries of lakes (Ref. 10348). Two or more males cluster with a single female near the surface. They press close to the female, often breaking the surface of the water, and eggs and milt are released (Ref. 27547). Some populations spawn exclusively at night (Ref. 10348), but others show no variation from daytime spawning (Ref. 10349). There is often, perhaps usually, heavy postspawning mortality (Ref. 27547).
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Usually spawns in spring, but spawning may extend into late summer in some lakes. Most spawners are age I or II (Becker 1983, Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Percopsis omiscomaycus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAGTTTTCGGTGCCTGAGCCGGCATAGTCGGCACGGCCCTAAGCCTGCTGATTCGGGCCGAATTAAGTCAACCCGGGGCCCTTCTTGGGGACGACCAAATTTACAATGTAGTCGTCACAGCACACGCTTTCGTAATAATCTTCTTCATGGTGATACCTATCATAATTGGGGGCTTCGGCAACTGATTAATCCCCCTAATAATTGGCGCCCCCGACATGGCCTTCCCGCGAATAAATAACATAAGCTTCTGGCTTCTCCCTCCCTCCTTCCTTCTCCTGCTTGCCTCCTCGGGCGTAGAGGCGGGAGCGGGCACGGGGTGGACCGTCTACCCGCCCCTGGCGGGTAACCTTGCCCACGCAGGGGCCTCCGTCGACCTCACAATTTTCTCCCTGCACCTTGCAGGTGCCTCTTCTATCCTCGGGGCTGTAAATTTTATTACAACAATTATTAACATAAAACCGCCTGCGATCTCTCAGTACCAGACACCCCTGTTTGTCTGATCCGTGCTCATTACCGCCGTACTGCTGCTTTTGTCCCTCCCAGTTCTCGCAGCCGGAATTACAATGCTGCTCACTGACCGAAACCTGAATACAACCTTCTTTGACCCTGCAGGGGGAGGAGACCCAATTCTTTATCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Percopsis omiscomaycus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Secure - widespread and abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but presumably exceeds 1,000,000. The species is relatively abundant within its range in Canada and the lower 48 states (Mecklenburg et al. 2002). In Heming Lake, Manitoba, the adult fish population was estimated at 2,929 to 3,636 fish per hectare (Morrow 1980)

Declines in area of occupancy, number of subpopulations, and abundance have occurred in the southern part of the range.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Long Term Trend: Decline of 30-50%

Comments: Declines in area of occupancy, number of subpopulations, and abundance have occurred in the southern part of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
On a range-wide scale no major threats are known. In the southern part of the range, degradation of lakes and streams has negatively affected distribution and abundance.

Trout-perch are especially sensitive to aquatic pollution and sedimentation associated with row crop agriculture and channelization (Pflieger 1997). Fish exposed to pulp mill effluent on the Kapuskasing River, Ontario, showed a change in age structure that was likely driven by an increase in mortality (Gibbons et al. 1998). This species may also be temperature sensitive; summer die-offs in Minnesota lakes have been attributed to higher than average temperatures (Eddy and Underhill 1974). A marked decline in the Red Deer River, Alberta trout-perch population was attributed to the impacts of a dam built there (Nelson, pers. comm., in Bramblett 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: On a range-wide scale no major threats are known. In the southern part of the range, degradation of lakes and streams has negatively affected distribution and abundance.

Trout-perch are especially sensitive to aquatic pollution and sedimentation associated with row crop agriculture and channelization (Pflieger 1997). Fish exposed to pulp mill effluent on the Kapuskasing River, Ontario, showed a change in age structure that was likely driven by an increase in mortality (Gibbons et al. 1998). This species may also be temperature sensitive; summer die-offs in Minnesota lakes have been attributed to higher than average temperatures (Eddy and Underhill 1974). A marked decline in the Red Deer River, Alberta trout-perch population was attributed to the impacts of a dam built there (Nelson, pers. comm., in Bramblett 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in national parks and other protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: public aquariums; bait: occasionally
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Percopsis omiscomaycus

Percopsis omiscomaycus also known as the trout-perch, the grounder or the sand minnow, is one of two species in the family Percopsidae. They are freshwater fish that prefers clear to slightly turbid water. They are most often seen washed up on beaches and are rarely seen alive or correctly identified. They are found in rivers and lakes throughout North America.[2] Its name comes from the Greek root words perc, meaning perch and opsi meaning appearance. The species name omiscomaycus is thought to be derived from a Native American word meaning trout. The trout-perch possess characteristics similar to both the trout and the perch.[3] They are an important source of food for many predator fish such as walleye, northern pike, and lake trout. They are a generally small fish found in deep waters by day, but which migrate to shallower waters at night. They are not a major human fishery, but are occasionally used as a bait fish.[2]

Geographic distribution[edit]

The trout-perch is found throughout North America, from Canada and Alaska to the Potomac river basin in Virginia. They are found in the Great lakes making them present in Illinois, Indiana, Michigan, Minnesota, New York, Ohio, Pennsylvania and Wisconsin. They are also found in the Mississippi River Basin which extends its range to include: Iowa, Missouri, Kentucky, Tennessee, Arkansas, Mississippi, and Louisiana. They have also been spotted in North Dakota, Montana and West Virginia.[2]

Physical description[edit]

Trout-perch (Goulais B).JPG

Size[edit]

The trout-perch has been found at sizes of 20.0 centimetres (7.9 in) total length (TL) but the average total length is 8.8 centimetres (3.5 in). There are no distinguishing characteristics between males and females.

Color[edit]

They are overall silvery or nearly transparent in appearance with rows of dark spots on along the sides of their bodies both along their lateral line and above it.[2] Their fins are almost entirely transparent. These fish have thick bodies with a long head, long snout, and a small mouth.[3]

Scales and fins[edit]

They have a single dorsal fin containing 1–3 spines and 10–11 soft rays. They also an adipose fin, similar to trout, which helps to distinguishes them from their look a likes the yellow perch and the walleye.[2] Their tail or caudal fin is forked. As most bony fishes, the trout-perch has thin, flexible plates of bone or leptoid scales. Their particular leptoid scales are ctenoid scales that are similar to the perch's.

Habitat, diet, and predators[edit]

Trout-perch prefer clear to slightly turbid water with sandy and gravely bottoms. They avoid shallow soft-bottomed areas. They participate in a daily migration, traveling from deep water during the day to shallow waters at night. This behavior is not only very important to their predators; the walleye, the northern pike, and the lake trout, but also in transporting nutrients in thermally stratified lakes. The nocturnal migration allows for foraging under the cover of night. The trout-perch feeds on a variety of small invertebrates including insect larvae and crustaceans.[2] Juveniles feed on zooplankton. Larger adults will eat small fish such as the johnny darter.

Breeding[edit]

The trout-perch becomes sexually mature at 1–3 years of age. The spawning season is May through August. The spawning site consists of sandbars and rocks in lakes or on gravel or sand in tributary streams. Three to four males will surround a single female and release their sperm as the female is releasing her eggs. The eggs will be fertilized and sink to the bottom of the lake. A single female can lay 200–700 eggs, which receive no parental care. The eggs will hatch in six days when the water temperature is 20–23 °C (68–73 °F).[2] The life span of the trout-perch is around 4 years.

References[edit]

  1. ^ NatureServe (2013). "Percopsis omiscomaycus". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. Retrieved January 26, 2014. 
  2. ^ a b c d e f g Bosanko, Dave (2007), "Fish of Minnesota – Field Guide", pp. 162–163, Adventure Publication, Cambridge, MN. ISBN 1-591-93192-4
  3. ^ a b Bramblett, Robert, "Montana Cooperative Fishery Research Unit", Department of Ecology, Montana State University-Bozeman.http://www.fisheriessociety.org/AFSmontana/SSCpages/Trout-perch.htm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The family Percopsidae, found only in North America, contains two species: the trout-perch (Percopsis omiscomaycus) and the sand roller (P. transmontana).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!