Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found at the reef edge, in sand and rubble areas (Ref. 9710) usually in small groups (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in Christmas Island, Australia and in the western Pacific from the Solomon Islands, north to southern Japan, south to Rowley Shoals and New South Wales (Australia). It was recently reported from Tonga. It is replaced by Halichoeres leucoxanthus in the Indian Ocean, but with overlapping distributions in Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Indian Ocean: Christmas Island. Western Pacific: Solomon Islands, north to southern Japan, south to Rowley Shoals and New South Wales (Australia). Recently reported from Tonga (Ref. 53797). Replaced by Halichoeres leucoxanthus in the Indian Ocean, but with overlapping distributions in Indonesia (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 11 - 12; Vertebrae: 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 120 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

In life, body bright yellow, head and thorax yellow-orange; a spot behind eye; head with irregular light-green bands. Dorsal fin of males with a large black, white-rimmed spot at the first interspinous membrane (another spot may appear on the soft portion between 2nd and 3rd rays for smaller males); females with a second black, light yellow-rimmed spot; smaller females and juveniles with a third blackish spot on penultimate membrane. Anterior lateral line scales with 2-4 pores; 6-12 suborbital pores. Pelvic fins not reaching anus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Halichoeres chrysus Randall
Catalog Number: USNM 221623
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall & et al.
Year Collected: 1974
Locality: Marshall Islands, Enewetak Atoll, Lagoon Off Japtan (David) Island., Eniwetok Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 18.5 to 18.5
  • Paratype: Randall, J. E. 1980. Pacific Science. 34 (4): 416.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits outer reef slopes from 10-30 m (Kuiter, 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 1 - 36
  Temperature range (°C): 25.335 - 28.905
  Nitrate (umol/L): 0.053 - 2.632
  Salinity (PPS): 33.507 - 35.376
  Oxygen (ml/l): 4.504 - 4.812
  Phosphate (umol/l): 0.108 - 0.284
  Silicate (umol/l): 0.819 - 7.618

Graphical representation

Depth range (m): 1 - 36

Temperature range (°C): 25.335 - 28.905

Nitrate (umol/L): 0.053 - 2.632

Salinity (PPS): 33.507 - 35.376

Oxygen (ml/l): 4.504 - 4.812

Phosphate (umol/l): 0.108 - 0.284

Silicate (umol/l): 0.819 - 7.618
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 70 m (Ref. 90102), usually 15 - 60 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 1 - 36
  Temperature range (°C): 25.335 - 28.905
  Nitrate (umol/L): 0.053 - 2.632
  Salinity (PPS): 33.507 - 35.376
  Oxygen (ml/l): 4.504 - 4.812
  Phosphate (umol/l): 0.108 - 0.284
  Silicate (umol/l): 0.819 - 7.618

Graphical representation

Depth range (m): 1 - 36

Temperature range (°C): 25.335 - 28.905

Nitrate (umol/L): 0.053 - 2.632

Salinity (PPS): 33.507 - 35.376

Oxygen (ml/l): 4.504 - 4.812

Phosphate (umol/l): 0.108 - 0.284

Silicate (umol/l): 0.819 - 7.618
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 60m.
From 2 to 60 meters.

Habitat: reef-associated. Found at the reef edge, in sand and rubble areas (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Found at the reef edge, isolated coral heads, in sand and rubble areas (Ref. 9710, 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halichoeres chrysus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATATAGTATTCGGAGCCTGAGCCGGGATGGTAGGCACAGCCCTAAGCTTATTAATTCGAGCTGAATTAAGCCAGCCCGGTGCTCTCCTCGGAGACGACCAAATCTACAATGTTATCGTTACAGCCCACGCTTTCGTAATAATTTTCTTCATAGTTATACCCATCATAATTGGCGGGTTCGGAAATTGACTAATTCCGCTAATGATTGGAGCACCTGATATGGCCTTCCCTCGAATAAACAATATAAGCTTTTGACTTCTCCCTCCTTCCTTTCTCCTTCTCCTTGCCTCATCAGGGGTAGAAGCAGGGGCAGGAACTGGCTGAACAGTTTATCCTCCTCTCGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTAACTATCTTTTCCCTCCACTTAGCCGGAATTTCATCTATTCTAGGTGCAATTAACTTTATTACTACAATTATTAACATAAAACCTCCGGCCATTTCCCAATATCAAACACCCCTGTTTGTCTGAGCCGTGCTCATTACAGCAGTTCTTCTTCTCCTCTCTCTTCCCGTCCTAGCTGCTGGTATTACCATGCTCCTAACAGATCGAAACCTTAATACTACTTTCTTTGATCCCGCCGGAGGAGGAGACCCCATTCTTTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halichoeres chrysus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Choat, J.H. & Yeeting, B.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This is a small species with a widespread distribution in the eastern Indian Ocean and western Pacific. It is targeted for the aquarium trade, but it is not thought to be a major threat. This species is listed as least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species, although it is exploited for the aquarium trade and is a target fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures in place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Canary wrasse

Halichoeres chrysurus, the canary wrasse, is a species of wrasse native to the eastern Indian Ocean and the western Pacific Ocean. It can be found around the edges of coral reefs at depths from 2 to 70 m (6.6 to 229.7 ft). It reaches 12 cm (4.7 in) in total length and is mostly bright yellow in color. This species can be found in the aquarium trade.[2]

References[edit]

  1. ^ Choat, J.H. & Yeeting, B. 2010. Halichoeres chrysus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Halichoeres chrysus" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!