Overview

Comprehensive Description

Biology

Found over rocks and corals at depths of at least 100 m. Feeds mainly on benthic invertebrates, also on fishes and squids (Ref. 4787, 5213).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Epinephelus albomarginatus occurs along the east coast of South Africa (KwaZulu-Natal and Eastern Cape provinces to 33°S) and southern Mozambique (to 24°50'S). The species is relatively abundant only between 32°15'S and 24°50'S. The species has also been recorded from the southwest coast of India. See the assessment justification for details on extent of occurrence and area of occupancy.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: Quissico, Mozambique to East London, South Africa.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 14; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 5222)); max. published weight: 13.0 kg (Ref. 4787)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Closely associated with reefs, mainly in water >30 m deep. There is very little evidence of spawning on exploited reefs in KwaZulu-Natal, possibly because of edge of range effects (Fennessy 2000), or unsuitable habitat. The species is a slow-growing, monandric protogynous hermaphrodite i.e., males are derived from functional females, and the sex ratio in KwaZulu-Natal is heavily female biased; it is not clear whether this is as a result of fishing pressure or because of edge of range effects on reproduction. In Mozambique, where fishing effort was light at time of sampling, the sex ratio was less biased (Fennessy 2000).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 10 - 100 m (Ref. 5222)
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 100 - 150m.
From 100 to 150 meters.

Habitat: reef-associated. White-edged rockcod. Attains 90 cm. Known only from southern Mozambique to East London. Common in 10 - 70 metres. Found over rocks and corals at depths of at least 100 m. Feeds mainly on benthic invertebrates, also on fishes and squids.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found over rocks and corals at depths of at least 100 m. Feeds mainly on benthic invertebrates, also on fishes and squids (Ref. 4787, 5213).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Epinephelus albomarginatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Epinephelus albomarginatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACAGCCCTCAGCCTACTAATTCGAGCTGAGCTAAGCCAACCGGGGGCTCTACTAGGCGACGACCAAATCTATAACGTAATTGTCACAGCACACGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGTGGCTTTGGAAACTGACTTATTCCCCTTATAATCGGTGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGCTTCTGACTTCTTCCCCCATCTTTCCTGCTTCTTCTTGCTTCTTCTGGTGTAGAAGCTGGGGCTGGTACTGGTTGAACAGTGTATCCCCCCTTGGCCGGAAACTTGGCCCATGCAGGTGCATCTGTAGACCTAACTATTTTTTCCCTACATTTAGCGGGGATTTCATCAATTCTAGGGGCAATTAACTTTATCACAACCATTATTAATATGAAACCCCCCGCCATCTCTCAATACCAAACACCTTTGTTTGTATGAGCCGTACTAATTACCGCAGTGCTTCTACTCCTCTCTCTTCCTGTTCTTGCCGCCGGCATTACAATACTACTAACAGATCGTAACCTAAACACCACTTTCTTCGACCCAGCCGGAGGGGGAGACCCGATTCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2d

Version
3.1

Year Assessed
2004

Assessor/s
Fennessy, S. (Grouper & Wrasse Specialist Group)

Reviewer/s
Sadovy, Y. & Cornish, A. (Grouper & Wrasse Red List Authority)

Contributor/s

Justification
In KwaZulu-Natal (South Africa), the mean size of this fish declined from 588 mm TL to 557 mm TL from the mid-1980s to the mid-1990s, and fishing mortality has reduced spawning biomass per recruit to 23% of the unexploited level in KwaZulu-Natal (Fennessy 2000). No historical CPUE (catch per unit of effort) data or historical sex ratio data are available. Fishing effort in Mozambique is now substantially higher now than in the mid-1990s, although there are no CPUE data currently available.

Although there is no evidence for a decline in extent of occurrence, the species has a very restricted range. The reported range is from 24°50'S to 33°S (Heemstra and Randall 1993). The species mainly occurs in water depths from 30?80 m, and, based on calculated sea floor area to the 100 m isobath, the extent of occurrence of the species is therefore about 16,000 km². The area of occupancy is in reality much less than this, since the species is closely reef-associated, and assuming that 10% of the area of occurrence is reef, then effective habitat (reef) area is about 1,600 km².

This species is classified as Vulnerable as current data indicate a population reduction down to 23% of spawning biomass and hence > 30% population reduction is inferred due to fishing over a 10 year or three generation period where the time period includes both the past and the future, and fishing effort has increased. The species has a highly limited geographic range for a pelagic spawner but, although the EOO and AOO are small and would also qualify the species under B2b(v), there is no evidence of fluctuations or fragmentation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Not common in South African waters, probably more abundant in Mozambique. The South African population is assumed to be the same stock as in Mozambique.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Over-fishing by small-scale commercial hook and line fishing in South Africa and Mozambique, and an industrial trap fishery in Mozambique poses a high threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2d)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Good protection in a 155 km long marine protected area (MPA) in South Africa. A minimum size limit of 400 mm TL applies, and a recreational bag limit of five fish per person per day (within that category of fish). Commercial fishing effort is restricted (number of permits is limited) and has recently been reduced. Fairly good compliance with regulations owing to an active conservation agency in KwaZulu-Natal. No bag or size limit restrictions in Mozambique.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Captain fine


Epinephelus albomarginatus (captain fine, white-edged grouper or white-edged rockcod) is a species of fish in the Serranidae family. It is found in Mozambique and South Africa. Its natural habitats are coral reefs.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!