Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

The Indo-Pacific lionfishes Pterois volitans and P. miles (in the scorpionfish family, Scorpaenidae) were at one time not distinguished from each other, but today they are widely recognized as distinct species based on morphometric and mitochondrial DNA analyses (Hamner et al. 2007; Betancur-R. et al. 2011; Eschmeyer 2012). Both of these predatory, venomous species have achieved notoriety during the past decade as they have invaded the western Atlantic with extraordinary speed, raising major concerns about their impacts on native hard-bottom, mangrove, seagrass, and coral reef communities. These lionfishes have now been far more thoroughly studied in the western Atlantic than in their native range. In a study in the Bahamas (Green et al. 2012), lionfish abundance was found to have increased rapidly between 2004 and 2010, by which time lionfish accounted for nearly 40% of the total predator biomass in the system. This increase in lionfish abundance coincided with a rapid (over just two years) 65% decline in the biomass of the 42 Atlantic fishes recorded as lionfish prey.

The lionfish invasion has spread all along the coastal Yucatan Peninsula, including the entire Mesoamerican coral reef, and throughout the Caribbean as far as Venezuela (Valdez-Moreno et al. 2012). Lionfish were first recorded in the western Atlantic in 2000. They have been established from Miami to North Carolina (U.S.A.) since 2002, around the Greater Antilles since 2007, and around the Florida Keys and Gulf of Mexico since 2009. Lionfish were numerous around Bermuda by 2004 and established in the Bahamas by 2005. Since 2009, lionfish have extended their range to include the Caribbean coasts of Mexico and Central and South America to Venezuela. It is unclear whether they will be able to spread south of Brazil or Uruguay. Juveniles can be found as far north as Rhode Island (U.S.A.), but under current climate conditions they apparently cannot withstand winter temperatures north of North Carolina. Lionfishes are the first nonnative marine fishes to establish in the western North Atlantic and Caribbean, although at one time or another dozens of of non-native marine fishes (most from the Indo-Pacific) have been documented in the coastal waters off Florida. (Schofield 2010) The native range for P. volitans is the Indo-West Pacific: Christmas and Cocos (Keeling) Islands in the Indian Ocean and in the western Pacific from French Polynesia and the Line Islands to Australia and Japan. The native range for P. miles is in the Red Sea and Indian Ocean: East and South Africa, Madagascar, and the Mascarenes east to Indonesia; P. miles has reached the Mediterranean Sea from the Red Sea through the Suez Canal. (Eschmeyer 2012)

The establishment of lionfish in the western Atlantic is believed to be the result of accidental or intentional releases from aquaria. Genetic analyses have revealed a striking reduction in genetic diversity in introduced populations relative to their native ranges (Hamner et al. 2007; Betancur-R. et al. 2011), but this has not caused any obvious problems for these new populations, which reach densities far higher than do populations in their native range (Kulbicki et al. 2012). Mitochondrial DNA screening of western Atlantic lionfish has shown that while P. miles is restricted to the northernmost locations (Bermuda and the east coast of the United States), P. volitans is ubiquitous and much more abundant (Betancur-R. et al. 2011).  Discouragingly, modeling by Barbour et al. (2011) suggests that effective lionfish removal programs would be very difficult to implement and maintain.

The venom-packing spines of lionfish pose a danger to anyone handling them.

Albins and Lyons (2012) reported a previously undescribed technique used by P. volitans to capture fish prey. While slowly approaching prey, lionfish produce jets of water directed toward their prey. These jets may confuse or distract prey and often result in prey fish facing the attacking lionfish, increasing the probability of head-first capture and swallowing.

Morris et al. (2009) provided an overview of the biology and ecology of P. volitans and P. miles.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Lifestyle

Red lionfish live alone. During the day you will find them resting under a coral ledge or in a cave. At sunset, they will leave their home and swim over the reef, hunting for food by sneaking up behind their prey and using their feather-like rays to hide their movement. Then with one big gulp, they swallow their prey whole!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabit lagoon and seaward reefs from turbid inshore areas to depths of 50 m. Often solitary, they hide in unexposed places at daytime often with head down and practically immobile. Pelagic juveniles expatriate over great distances and the reason for their broad geographical range (Ref. 48635). Hunt small fishes, shrimps, and crabs at night, using its widespread pectorals trapping prey into a corner, stunning it and then swallowing it in one sweep. Dorsal spines are venomous; the sting can be treated by heating the afflicted part and application of corticoids (Ref. 5503). A popular table fish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The red lionfish, Pterois volitans, is an Indo-Pacific marine fish that has been recently introduced to the east coast of the United States including coastal Florida.P. volitans is banded with distinct red and white stripes that give the fish its alternate common name "zebrafish". The elaborate fan-like pectoral fins and long separated dorsal spines explain the alternate common name-"turkeyfish". Fleshy tabs around the mouth and above the eyes are another characteristic feature of the species (Myers 1991, Whitfield et al. 2002, FishBase).The long dorsal and pectoral spines of P. volitans are venomous, with the venom being produced by glands located in grooves on the spines covered integument (Halstead et al. 1955, Ruiz-Carus et al. 2006). The spines are used by the lionfish both for predator deterrence and to facilitate prey capture.The fin-ray count is: dorsal XIII, 13; anal III, 7-8 (last 2 soft rays are united at the base); pectorals (left/right) 14/14; pelvics (left/ right) I, 5/I, 5 (Ruiz-Carus et al. 2006).
  • Allen G.R., and W.N. Eschmeyer. 1973. Turkeyfishes at Eniwetok. Pac. Disc. 26:3-11.
  • Baker P., Baker S.M., and J. Fajans. 2004. Nonindigenous marine species in the greater Tampa Bay ecosystem. Tampa Bay Estuary Program Technical Publication #02-04. 131p.
  • Courtenay W.R., Jr.. 1995. Marine fish introductions in southeastern Florida. American Fisheries Society Introduced Fish Section Newsletter 14:2-3.
  • Fishelson L. 1975. Ethology and reproduction of pteroid fishes found in the Gulf of Aqaba (Red Sea), especially Dendrochirus brachypterus (Cuvier), (Pteroidae, Teleostei). PSZN 39 (Suppl. 1):635-656.
  • Halstead B.W., Chitwood M.J., and F.R. Modglin 1955. The anatomy of the venom apparatus of the zebrafish Pterois volitans (Linnaeus). The Anatomical Record 122:317-333.
  • Kimball M.E., Miller J.M., Whitfield P.E., and J.A. Hare. 2004. Thermal tolerance and potential distribution of invasive lionfish (Pterois volitans/miles complex) on the east coast of the United States. Marine Ecology Progress Series 283:269-278.
  • Meister H.S., Wyanski D.M, Loefer J.K., Ross S.W., Quattrini A.M., and K.J. Sulak. 2005. Further evidence for the invasion and establishment of Pterois volitans (Teleostei: Scorpaenidae) along the Atlantic Coast of the United States. Southeastern Naturalist 4:193-206.
  • Myers R.F. 1991. Micronesian Reef Fishes. Second Edition. Coral Graphics, Barrigada, Guam. 298 p.
  • Ruiz-Carus R., Matheson R.E., Jr., Roberts D.E., Jr., and P.E. Whitfield. 2006. The western Pacific red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and parasitism in the first exotic marine fish established in state waters. Biological Conservation 128:384-390.
  • Sano M., Shimizu, M., and Y. Nose. 1984. Food Habits of Teleostean Reef Fishes in Okinawa Island, Southern Japan. University of Tokyo Press, Japan. 128 p.
  • Schultz E.T. 1986. Pterois volitans and Pterois miles: two valid species. Copeia 1986:686-690.
  • Whitfield P.E., Gardner T., Vives S.P., Gilligan M.R., Coutenay, W.R., Jr., Ray, G.C., and J.A. Hare. 2002. Biological invasion of the Indo-Pacific lionfish Pterois volitans along the Atlantic coast of North America. Marine Ecology Progress Series 235:289-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The red lionfish may look beautiful, but it is dangerous! It has 13 poisonous spines on its back, which it uses to protect itself from predators and to defend its home. The red lionfish never learned to share its home; it will charge at other lionfish with its poisonous spines to drive them away. When male lionfish are trying to find a female, they will charge and bite other male lionfish, sometimes even tearing parts of their mouth off! Their poisonous spines are not deadly to humans, but are extremely painful.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific; exotic established New York to Florida
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific; invasive in the western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific Ocean: Cocos-Keeling Islands and Western Australia (Ref. 27362) in the eastern Indian Ocean to the Marquesas and Oeno (Pitcairn group), north to southern Japan and southern Korea, south to Lord Howe Island, northern New Zealand, and the Austral Islands. Replaced by the very similar Pterois miles from the Red Sea to Sumatra.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Native Range:

Indo-Pacific: western Australia and Malaysia to the Marquesas Islands and Oeno; north to southern Japan and southern Korea; south to Lord Howe, Kermadec, and Austral Island (  map of the indigenous occurrances of Pterois volitans).

Nonnative Range:

Pterois volitans was introduced to Key Biscayne, Florida when a beachside aquarium broke during Hurricane Andrew in 1992. Furthermore, the intentional release of aquarium pets has contributed to the Florida population (USGS, 1999). It is not know what the biological implications of this introduction might be (  map showing the nonindigenous occurrences of Pterois volitans).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pterois volitans is native to the western Pacific (from southern Japan and southern Korea to the east coast of Australia, Indonesia, Micronesia and French Polynesia) and South Pacific (from western Australia to the Marquesas and Oeno in the Pitcairn Islands) (Schultz 1986 Myers 1991, Ruiz-Carus et al. 2006). The species has recently been observed and collected from the U.S. east coast from Florida north to Long Island, New York (Whitfield et al., 2002). Pterois volitans has yet to be observed or collected from the India River Lagoon proper, but it has been collected from coastal waters at both the northern and southern ends of the India River Lagoon region. At the northern end of the India River Lagoon system, collections have been made in coastal waters off of Ponce Inlet, south off of Daytona and Cape Canaveral, and approximately 40 km SE of Port Canaveral. To the south, repeated observations and collections have been made in coastal waters off of Lake Worth, located approximately 40 km south of Jupiter Inlet in Palm Beach County.Red lionfish inhabit lagoons and turbid inshore areas and harbors as well as offshore reefs in their native range (Schultz 1986, Myers, 1991), so concern exists as to whether the species might eventually become established within the India River Lagoon proper and within other Florida estuaries as well. On the west coast of the state, P. volitans is considered a potential invasive of the greater Tampa Bay ecosystem (Baker et al. 2004).
  • Allen G.R., and W.N. Eschmeyer. 1973. Turkeyfishes at Eniwetok. Pac. Disc. 26:3-11.
  • Baker P., Baker S.M., and J. Fajans. 2004. Nonindigenous marine species in the greater Tampa Bay ecosystem. Tampa Bay Estuary Program Technical Publication #02-04. 131p.
  • Courtenay W.R., Jr.. 1995. Marine fish introductions in southeastern Florida. American Fisheries Society Introduced Fish Section Newsletter 14:2-3.
  • Fishelson L. 1975. Ethology and reproduction of pteroid fishes found in the Gulf of Aqaba (Red Sea), especially Dendrochirus brachypterus (Cuvier), (Pteroidae, Teleostei). PSZN 39 (Suppl. 1):635-656.
  • Halstead B.W., Chitwood M.J., and F.R. Modglin 1955. The anatomy of the venom apparatus of the zebrafish Pterois volitans (Linnaeus). The Anatomical Record 122:317-333.
  • Kimball M.E., Miller J.M., Whitfield P.E., and J.A. Hare. 2004. Thermal tolerance and potential distribution of invasive lionfish (Pterois volitans/miles complex) on the east coast of the United States. Marine Ecology Progress Series 283:269-278.
  • Meister H.S., Wyanski D.M, Loefer J.K., Ross S.W., Quattrini A.M., and K.J. Sulak. 2005. Further evidence for the invasion and establishment of Pterois volitans (Teleostei: Scorpaenidae) along the Atlantic Coast of the United States. Southeastern Naturalist 4:193-206.
  • Myers R.F. 1991. Micronesian Reef Fishes. Second Edition. Coral Graphics, Barrigada, Guam. 298 p.
  • Ruiz-Carus R., Matheson R.E., Jr., Roberts D.E., Jr., and P.E. Whitfield. 2006. The western Pacific red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and parasitism in the first exotic marine fish established in state waters. Biological Conservation 128:384-390.
  • Sano M., Shimizu, M., and Y. Nose. 1984. Food Habits of Teleostean Reef Fishes in Okinawa Island, Southern Japan. University of Tokyo Press, Japan. 128 p.
  • Schultz E.T. 1986. Pterois volitans and Pterois miles: two valid species. Copeia 1986:686-690.
  • Whitfield P.E., Gardner T., Vives S.P., Gilligan M.R., Coutenay, W.R., Jr., Ray, G.C., and J.A. Hare. 2002. Biological invasion of the Indo-Pacific lionfish Pterois volitans along the Atlantic coast of North America. Marine Ecology Progress Series 235:289-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 10 - 11; Analspines: 3; Analsoft rays: 6 - 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The lionfish has a beautifully banded head and body with reddish or golden brown bands stretching across a yellow background. The dorsal and anal fins possess dark rows of spots on a clear background.

Pterois volitans are differentiated from other scorpionfishes by having 13 rather than 12 poisonous dorsal spines and 14 long, feather-like pectoral rays. The anal fin has 3 spines and 6-7 rays.

Pterois volitans can grow to a maximum length of 38 cm.

Some other noteworthy characteristics of Pterois volitans are the bony ridge across the cheek and the flaps that partially cover both the eyes and nose. They also possess a "tentacle" above both eyes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 380 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

38.0 cm TL (male/unsexed; (Ref. 2334)); max. reported age: 10 years (Ref. 72479)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The largest Pterois volitans specimen collected on the U.S. east coast, caught via hook and line off North Carolina in 2004, was over 43 cm long and weighed approximately 1.1 kgBaker et al. (2004) indicate that the species typically grows to 15-30 cm.
  • Allen G.R., and W.N. Eschmeyer. 1973. Turkeyfishes at Eniwetok. Pac. Disc. 26:3-11.
  • Baker P., Baker S.M., and J. Fajans. 2004. Nonindigenous marine species in the greater Tampa Bay ecosystem. Tampa Bay Estuary Program Technical Publication #02-04. 131p.
  • Courtenay W.R., Jr.. 1995. Marine fish introductions in southeastern Florida. American Fisheries Society Introduced Fish Section Newsletter 14:2-3.
  • Fishelson L. 1975. Ethology and reproduction of pteroid fishes found in the Gulf of Aqaba (Red Sea), especially Dendrochirus brachypterus (Cuvier), (Pteroidae, Teleostei). PSZN 39 (Suppl. 1):635-656.
  • Halstead B.W., Chitwood M.J., and F.R. Modglin 1955. The anatomy of the venom apparatus of the zebrafish Pterois volitans (Linnaeus). The Anatomical Record 122:317-333.
  • Kimball M.E., Miller J.M., Whitfield P.E., and J.A. Hare. 2004. Thermal tolerance and potential distribution of invasive lionfish (Pterois volitans/miles complex) on the east coast of the United States. Marine Ecology Progress Series 283:269-278.
  • Meister H.S., Wyanski D.M, Loefer J.K., Ross S.W., Quattrini A.M., and K.J. Sulak. 2005. Further evidence for the invasion and establishment of Pterois volitans (Teleostei: Scorpaenidae) along the Atlantic Coast of the United States. Southeastern Naturalist 4:193-206.
  • Myers R.F. 1991. Micronesian Reef Fishes. Second Edition. Coral Graphics, Barrigada, Guam. 298 p.
  • Ruiz-Carus R., Matheson R.E., Jr., Roberts D.E., Jr., and P.E. Whitfield. 2006. The western Pacific red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and parasitism in the first exotic marine fish established in state waters. Biological Conservation 128:384-390.
  • Sano M., Shimizu, M., and Y. Nose. 1984. Food Habits of Teleostean Reef Fishes in Okinawa Island, Southern Japan. University of Tokyo Press, Japan. 128 p.
  • Schultz E.T. 1986. Pterois volitans and Pterois miles: two valid species. Copeia 1986:686-690.
  • Whitfield P.E., Gardner T., Vives S.P., Gilligan M.R., Coutenay, W.R., Jr., Ray, G.C., and J.A. Hare. 2002. Biological invasion of the Indo-Pacific lionfish Pterois volitans along the Atlantic coast of North America. Marine Ecology Progress Series 235:289-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inhabits lagoon and seaward reefs from turbid inshore areas to depths of over 50 m. Hides in unexposed places at daytime often with head down and practically immobile. Hunts small fishes, shrimps, and crabs at night, using its widespread pectorals trapping prey into a corner, stunning it and then swallowing it in one sweep. Dorsal spines are venomous; the sting can be treated by heating the afflicted part and application of corticoids (Ref. 5503). A popular table fish.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Scales cycloid (Ref. 37816). Variable in color, usually in relation to habitat. Coastal species generally darker, sometimes almost black in estuaries. Often with large tentacles above eyes (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Pterois volitans is unmistakable for any other marine fish of the western Atlantic.
  • Allen G.R., and W.N. Eschmeyer. 1973. Turkeyfishes at Eniwetok. Pac. Disc. 26:3-11.
  • Baker P., Baker S.M., and J. Fajans. 2004. Nonindigenous marine species in the greater Tampa Bay ecosystem. Tampa Bay Estuary Program Technical Publication #02-04. 131p.
  • Courtenay W.R., Jr.. 1995. Marine fish introductions in southeastern Florida. American Fisheries Society Introduced Fish Section Newsletter 14:2-3.
  • Fishelson L. 1975. Ethology and reproduction of pteroid fishes found in the Gulf of Aqaba (Red Sea), especially Dendrochirus brachypterus (Cuvier), (Pteroidae, Teleostei). PSZN 39 (Suppl. 1):635-656.
  • Halstead B.W., Chitwood M.J., and F.R. Modglin 1955. The anatomy of the venom apparatus of the zebrafish Pterois volitans (Linnaeus). The Anatomical Record 122:317-333.
  • Kimball M.E., Miller J.M., Whitfield P.E., and J.A. Hare. 2004. Thermal tolerance and potential distribution of invasive lionfish (Pterois volitans/miles complex) on the east coast of the United States. Marine Ecology Progress Series 283:269-278.
  • Meister H.S., Wyanski D.M, Loefer J.K., Ross S.W., Quattrini A.M., and K.J. Sulak. 2005. Further evidence for the invasion and establishment of Pterois volitans (Teleostei: Scorpaenidae) along the Atlantic Coast of the United States. Southeastern Naturalist 4:193-206.
  • Myers R.F. 1991. Micronesian Reef Fishes. Second Edition. Coral Graphics, Barrigada, Guam. 298 p.
  • Ruiz-Carus R., Matheson R.E., Jr., Roberts D.E., Jr., and P.E. Whitfield. 2006. The western Pacific red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and parasitism in the first exotic marine fish established in state waters. Biological Conservation 128:384-390.
  • Sano M., Shimizu, M., and Y. Nose. 1984. Food Habits of Teleostean Reef Fishes in Okinawa Island, Southern Japan. University of Tokyo Press, Japan. 128 p.
  • Schultz E.T. 1986. Pterois volitans and Pterois miles: two valid species. Copeia 1986:686-690.
  • Whitfield P.E., Gardner T., Vives S.P., Gilligan M.R., Coutenay, W.R., Jr., Ray, G.C., and J.A. Hare. 2002. Biological invasion of the Indo-Pacific lionfish Pterois volitans along the Atlantic coast of North America. Marine Ecology Progress Series 235:289-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

reef-associated, depth range 2 - 55 m; inhabits lagoon and seaward reefs from turbid inshore areas maximum depth
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 55m.
From 2 to 55 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 55 m (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lionfish are primarily reef associated but also found in warm, marine water of the tropics (Grant, 1999). They tend to glide along the rocks and coral during the night and hide out in caves and crevices during the day.

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 218 specimens in 1 taxon.
Water temperature and chemistry ranges based on 137 samples.

Environmental ranges
  Depth range (m): 0.5 - 131.5
  Temperature range (°C): 22.098 - 29.171
  Nitrate (umol/L): 0.050 - 9.015
  Salinity (PPS): 34.090 - 35.262
  Oxygen (ml/l): 3.284 - 4.957
  Phosphate (umol/l): 0.085 - 0.760
  Silicate (umol/l): 1.005 - 11.713

Graphical representation

Depth range (m): 0.5 - 131.5

Temperature range (°C): 22.098 - 29.171

Nitrate (umol/L): 0.050 - 9.015

Salinity (PPS): 34.090 - 35.262

Oxygen (ml/l): 3.284 - 4.957

Phosphate (umol/l): 0.085 - 0.760

Silicate (umol/l): 1.005 - 11.713
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits lagoon and seaward reefs from turbid inshore areas to depths of 50 m. Hides in unexposed places at daytime often with head down and practically immobile. Pelagic juveniles expatriate over great distances and the reason for their broad geographical range (Ref. 48635). Hunts small fishes, shrimps, and crabs at night, using its widespread pectorals trapping prey into a corner, stunning it and then swallowing it in one sweep. Daylight hours are spent resting under ledges, in caves or among wreckage, either singly or in aggregations (Ref. 54301). Dorsal spines are venomous; the sting can be treated by heating the afflicted part and application of corticoids (Ref. 5503).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Pterois volitans is one of the top levels of the food web in many coral reef environments. They are known to feed mostly on crustaceans (as well as other invertebrates) and small fishes, which include juveniles of their own species. Pterois volitans consumes an average of 8.2 times its body weight per year (USGS, 1999). As juveniles they consume 5.5-13.5 g per day and 14.6 g a day as adults.

Sunset is an optimal time for Pterois volitans to begin feeding because this is when activity in the coral reef is highest. At sunset, all of the day fish and invertebrates make their way to a resting spot for the night and all of the night fish come out to begin feeding. With all of these creatures around, the lionfish need not invest much energy to find a meal. They simply glide upwards along the rock and coral sneaking up on unexpecting prey from below. While moving slowly towards a small fish, Pterois volitans uses its open pectoral rays to shield the motion of its caudal fin. This shielding along with the cryptic coloration of the predator prevents the prey from becoming alarmed. Although we find the striped colorful pattern of the lionfish obvious and easy to see in an aquarium setting, in the coral reef this colorful pattern allows the fish to blend into the background of coral branches, feather-stars, and spiny sea urchins.

The lionfish attacks with one swift gulping motion that sucks the prey into its mouth. This attack is so quick and smooth that if the victim is among a group of fish, the other fish in the group may not even notice what happened. The lionfish can continue to hunt the other unaware members of the group.

Pterois volitans has also been known to hunt for fish in the open water near the surface with a different technique. Here they wait 20-30 cm below the surface and watch for small schools of fish leaping out of the water in an attempt to escape another predator. When they plunge back into the water the lionfish is waiting just below them ready to attack (Fishelson, 1975)

In addition to fish, Pterois volitans feed on invertebrates such as amphipods, isopods, and other crustaceans. The lionfish glides along the substrate (rocks or sand) and vibrates the rays on its fins in order the rustle the food out of hiding.

In general, the lionfish is stationary and feeds on as many fish as it can when fish are plentiful and then it fasts when food is scarce (Fishelson, 1997). When a lot of food is available for feeding, Pterois volitans becomes satiated or full and may not eat for at least 24 hours (Fishelson, 1997).

Lionfish invest most of their energy in growing to a large body size early in life. This tactic allows them to grow big at a fairly young age so that they are more likely to avoid attack by predators and increase their chances of mating successfully (Stearns and Crandall, 1984).

If a male lionfish meets another male while hunting, the more aggressive male will turn darker in color and point its poisonous, spiny dorsal fins at the other individual who usually folds down its pectoral fins and swims away.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pterois volitans is a predator on small fish, shrimps, crabs, and similarly sized animals. The species actively hunts in open water at night (Myers, 1991).Allen and Eschmeyer (1973) note a hunting behavior in which P. volitans spreads its pectoral fins to corral prey items which it then ingests in a single rapid motion.
  • Allen G.R., and W.N. Eschmeyer. 1973. Turkeyfishes at Eniwetok. Pac. Disc. 26:3-11.
  • Baker P., Baker S.M., and J. Fajans. 2004. Nonindigenous marine species in the greater Tampa Bay ecosystem. Tampa Bay Estuary Program Technical Publication #02-04. 131p.
  • Courtenay W.R., Jr.. 1995. Marine fish introductions in southeastern Florida. American Fisheries Society Introduced Fish Section Newsletter 14:2-3.
  • Fishelson L. 1975. Ethology and reproduction of pteroid fishes found in the Gulf of Aqaba (Red Sea), especially Dendrochirus brachypterus (Cuvier), (Pteroidae, Teleostei). PSZN 39 (Suppl. 1):635-656.
  • Halstead B.W., Chitwood M.J., and F.R. Modglin 1955. The anatomy of the venom apparatus of the zebrafish Pterois volitans (Linnaeus). The Anatomical Record 122:317-333.
  • Kimball M.E., Miller J.M., Whitfield P.E., and J.A. Hare. 2004. Thermal tolerance and potential distribution of invasive lionfish (Pterois volitans/miles complex) on the east coast of the United States. Marine Ecology Progress Series 283:269-278.
  • Meister H.S., Wyanski D.M, Loefer J.K., Ross S.W., Quattrini A.M., and K.J. Sulak. 2005. Further evidence for the invasion and establishment of Pterois volitans (Teleostei: Scorpaenidae) along the Atlantic Coast of the United States. Southeastern Naturalist 4:193-206.
  • Myers R.F. 1991. Micronesian Reef Fishes. Second Edition. Coral Graphics, Barrigada, Guam. 298 p.
  • Ruiz-Carus R., Matheson R.E., Jr., Roberts D.E., Jr., and P.E. Whitfield. 2006. The western Pacific red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and parasitism in the first exotic marine fish established in state waters. Biological Conservation 128:384-390.
  • Sano M., Shimizu, M., and Y. Nose. 1984. Food Habits of Teleostean Reef Fishes in Okinawa Island, Southern Japan. University of Tokyo Press, Japan. 128 p.
  • Schultz E.T. 1986. Pterois volitans and Pterois miles: two valid species. Copeia 1986:686-690.
  • Whitfield P.E., Gardner T., Vives S.P., Gilligan M.R., Coutenay, W.R., Jr., Ray, G.C., and J.A. Hare. 2002. Biological invasion of the Indo-Pacific lionfish Pterois volitans along the Atlantic coast of North America. Marine Ecology Progress Series 235:289-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

A parasitic leach, Myzobdella lugubris, was found attached to the tongue of a red lionfish collected off of Jacksonville, FL. While this leach has been found on some two dozen freshwater and estuarine fish species, and on the blue crab (Callinectes sapidus), and a grass shrimp (Paleomonetes pugio), this finding represents the first record from a marine fish (Ruiz-carus et al. 2006).Invasion History: Pterois volitans is one of the most popular marine ornamental aquarium species, and this is the most likely avenue of introduction of this species to the U.S. Atlantic coast. The first documented release of red lionfish in the southeast was an accidental release of 6 individuals. This resulted from resulting from the Hurricane Andrew-related destruction of a large private aquarium located on a porch at the edge of Biscayne Bay in 1992 (Courtenay 1995). These fish were observed alive in the adjacent habitat several days later.Between 1993 and 2002, sporadic and often unsubstantiated sightings of P. volitans from the Florida east coast were recorded. Then, in February and March 2002, 3 specimens were caught off northeast Florida, near St. Augustine, Jacksonville, and Amelia Island. Two of these specimens were sent to the Florida Fish and Wildlife Conservation Commission's Fish and Wildlife Research Institute (FWRI) where positive identification was made (Ruiz-Carus et al. 2006).North of Florida, collections and observations of red lionfish began in 2001 with the capture of a single adult individual off Georgia and two juveniles off Long Island, New York. Since then, further collections and observations of live P. volitans occurring in natural habitats off Florida, Georgia, the Carolinas, New jersey, and New York have been made (Whitfield et al. 2002, Hare and Whitfield 2003, Ruiz-Carus et al. 2006).The observation of small aggregations of 2-4 P. volitans during manned submersible-based research dives off North Carolina and South Carolina in 2002 offer compelling evidence that a reproductive population may be established there. Although courtship behaviors and actual spawning were not observed, the typically solitary P. volitans usually forms small groups as a prelude to courtship and reproduction. Histological examination of an adult female specimen collected off of St. Augustine, FL, also suggests reproduction is occurring there, based on a regressed state of the mature ovaries indicative of a post-spawning condition (Ruiz-Carus et al. 2006).If P. volitans has become established in Florida, it is believed to be the first marine (non-estuarine) non-native fish to successfully do so. Potential to Compete With Natives: A broad array of suitable prey species for Pterois volitans occur on Florida reefs, as do a number of predatory fish with which this non-native species may come to compete over trophic resources (Fishelson 1975, Sano et al. 1984). Detailed information on Florida P. volitans population sizes and their food habits remains lacking, however. Possible Economic Consequences of Invasion: The potential economic impacts of Pterois volitans in Florida and elsewhere in the southeastern U.S. have yet to be assessed. The species is venomous and as such may pose a threat to fishermen and scuba divers.
  • Allen G.R., and W.N. Eschmeyer. 1973. Turkeyfishes at Eniwetok. Pac. Disc. 26:3-11.
  • Baker P., Baker S.M., and J. Fajans. 2004. Nonindigenous marine species in the greater Tampa Bay ecosystem. Tampa Bay Estuary Program Technical Publication #02-04. 131p.
  • Courtenay W.R., Jr.. 1995. Marine fish introductions in southeastern Florida. American Fisheries Society Introduced Fish Section Newsletter 14:2-3.
  • Fishelson L. 1975. Ethology and reproduction of pteroid fishes found in the Gulf of Aqaba (Red Sea), especially Dendrochirus brachypterus (Cuvier), (Pteroidae, Teleostei). PSZN 39 (Suppl. 1):635-656.
  • Halstead B.W., Chitwood M.J., and F.R. Modglin 1955. The anatomy of the venom apparatus of the zebrafish Pterois volitans (Linnaeus). The Anatomical Record 122:317-333.
  • Kimball M.E., Miller J.M., Whitfield P.E., and J.A. Hare. 2004. Thermal tolerance and potential distribution of invasive lionfish (Pterois volitans/miles complex) on the east coast of the United States. Marine Ecology Progress Series 283:269-278.
  • Meister H.S., Wyanski D.M, Loefer J.K., Ross S.W., Quattrini A.M., and K.J. Sulak. 2005. Further evidence for the invasion and establishment of Pterois volitans (Teleostei: Scorpaenidae) along the Atlantic Coast of the United States. Southeastern Naturalist 4:193-206.
  • Myers R.F. 1991. Micronesian Reef Fishes. Second Edition. Coral Graphics, Barrigada, Guam. 298 p.
  • Ruiz-Carus R., Matheson R.E., Jr., Roberts D.E., Jr., and P.E. Whitfield. 2006. The western Pacific red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and parasitism in the first exotic marine fish established in state waters. Biological Conservation 128:384-390.
  • Sano M., Shimizu, M., and Y. Nose. 1984. Food Habits of Teleostean Reef Fishes in Okinawa Island, Southern Japan. University of Tokyo Press, Japan. 128 p.
  • Schultz E.T. 1986. Pterois volitans and Pterois miles: two valid species. Copeia 1986:686-690.
  • Whitfield P.E., Gardner T., Vives S.P., Gilligan M.R., Coutenay, W.R., Jr., Ray, G.C., and J.A. Hare. 2002. Biological invasion of the Indo-Pacific lionfish Pterois volitans along the Atlantic coast of North America. Marine Ecology Progress Series 235:289-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Menu

Red lionfish eat crabs, shrimps, small fish, and even young lionfish! Because they only eat other animals, they are carnivores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Detailed abundance information for this recent invader to the U.S, Atlantic coast is lacking, but collection data and anecdotal observations suggest Pterois volitans is established and reproducing in Florida waters and that local populations are likely growing (Whitfield et al. 2002, Ruiz-Carus et al. 2006).
  • Allen G.R., and W.N. Eschmeyer. 1973. Turkeyfishes at Eniwetok. Pac. Disc. 26:3-11.
  • Baker P., Baker S.M., and J. Fajans. 2004. Nonindigenous marine species in the greater Tampa Bay ecosystem. Tampa Bay Estuary Program Technical Publication #02-04. 131p.
  • Courtenay W.R., Jr.. 1995. Marine fish introductions in southeastern Florida. American Fisheries Society Introduced Fish Section Newsletter 14:2-3.
  • Fishelson L. 1975. Ethology and reproduction of pteroid fishes found in the Gulf of Aqaba (Red Sea), especially Dendrochirus brachypterus (Cuvier), (Pteroidae, Teleostei). PSZN 39 (Suppl. 1):635-656.
  • Halstead B.W., Chitwood M.J., and F.R. Modglin 1955. The anatomy of the venom apparatus of the zebrafish Pterois volitans (Linnaeus). The Anatomical Record 122:317-333.
  • Kimball M.E., Miller J.M., Whitfield P.E., and J.A. Hare. 2004. Thermal tolerance and potential distribution of invasive lionfish (Pterois volitans/miles complex) on the east coast of the United States. Marine Ecology Progress Series 283:269-278.
  • Meister H.S., Wyanski D.M, Loefer J.K., Ross S.W., Quattrini A.M., and K.J. Sulak. 2005. Further evidence for the invasion and establishment of Pterois volitans (Teleostei: Scorpaenidae) along the Atlantic Coast of the United States. Southeastern Naturalist 4:193-206.
  • Myers R.F. 1991. Micronesian Reef Fishes. Second Edition. Coral Graphics, Barrigada, Guam. 298 p.
  • Ruiz-Carus R., Matheson R.E., Jr., Roberts D.E., Jr., and P.E. Whitfield. 2006. The western Pacific red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and parasitism in the first exotic marine fish established in state waters. Biological Conservation 128:384-390.
  • Sano M., Shimizu, M., and Y. Nose. 1984. Food Habits of Teleostean Reef Fishes in Okinawa Island, Southern Japan. University of Tokyo Press, Japan. 128 p.
  • Schultz E.T. 1986. Pterois volitans and Pterois miles: two valid species. Copeia 1986:686-690.
  • Whitfield P.E., Gardner T., Vives S.P., Gilligan M.R., Coutenay, W.R., Jr., Ray, G.C., and J.A. Hare. 2002. Biological invasion of the Indo-Pacific lionfish Pterois volitans along the Atlantic coast of North America. Marine Ecology Progress Series 235:289-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

fishes, shrimps, crabs
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
10.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Only while courting will Pterois volitans aggregate with other individuals. In this special case, one male will aggregate with several females to form groups of 3-8 fish.

When lionfish are ready to reproduce, the physical differences between the sexes become more obvious. Males turn darker and are more uniformly colored (their stripes are not as apparent). Females with ripening eggs become paler. Their belly, pharyngeal region, and mouth become silvery white. Such females are easy for the males to spot in the darkness.

Courtship begins just before dark and is always initiated by the males. After the male searches out a female, he rests next to her on the substrate and looks toward the water surface while propping himself up on his ventral fins. He then proceeds to circle the female. After circling several times, the male then ascends to the water surface with the female following behind. While ascending the female will tremble her pectoral fins. The couple may descend and ascend several times before spawning. On the final ascent the couple will swim around just under the surface of the water. The female will then release her spawn. These spawn are comprised of two hollow mucus tubes that float just below the surface upon release. After approximately 15 minutes, these tubes fill up with seawater and become oval balls 2 to 5 cm in diameter. Within these mucosal balls lie 1-2 layers of individual eggs. The number of eggs per ball varies from 2,000 to 15,000. As the female spawn are released, the male releases his sperm, which penetrate the mucosal balls and fertilize the eggs inside.

Twelve hours after fertilization the embryo begins to form. Only 18 hours after fertilization, the head and eyes become moderately developed. Eventually, invading microbes deteriorate the mucus walls and 36 hours after fertilization, the larvae hatch. Four days after conception, the larvae are already good swimmers and are able to begin feeding on small ciliates (Fishelson, 1975).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pterois volitans reproduction is sexual and involves external fertilization of eggs and a suite of complex courtship and mating behaviors (Ruiz-Carus et al. 2006). The species is generally solitary outside of the reproductive season, but during courtship, males will aggregate with multiple females to form groups of 3-8 fish. Fishelson (1975) indicates that competing males use their spines and fins in agonistic visual displays. Females release a pair of mucus-encapsulated clusters of 2,000-15,000 eggs to the pelagic environment where they are fertilized by the male. Environmental microbiota break down the egg mass mucus to free the eggs and facilitate hatching.Ovarian and testicular histological examination by Ruiz-Carus et al. (2006) suggests P. volitans reproduction in Florida occurs early in the year.
  • Allen G.R., and W.N. Eschmeyer. 1973. Turkeyfishes at Eniwetok. Pac. Disc. 26:3-11.
  • Baker P., Baker S.M., and J. Fajans. 2004. Nonindigenous marine species in the greater Tampa Bay ecosystem. Tampa Bay Estuary Program Technical Publication #02-04. 131p.
  • Courtenay W.R., Jr.. 1995. Marine fish introductions in southeastern Florida. American Fisheries Society Introduced Fish Section Newsletter 14:2-3.
  • Fishelson L. 1975. Ethology and reproduction of pteroid fishes found in the Gulf of Aqaba (Red Sea), especially Dendrochirus brachypterus (Cuvier), (Pteroidae, Teleostei). PSZN 39 (Suppl. 1):635-656.
  • Halstead B.W., Chitwood M.J., and F.R. Modglin 1955. The anatomy of the venom apparatus of the zebrafish Pterois volitans (Linnaeus). The Anatomical Record 122:317-333.
  • Kimball M.E., Miller J.M., Whitfield P.E., and J.A. Hare. 2004. Thermal tolerance and potential distribution of invasive lionfish (Pterois volitans/miles complex) on the east coast of the United States. Marine Ecology Progress Series 283:269-278.
  • Meister H.S., Wyanski D.M, Loefer J.K., Ross S.W., Quattrini A.M., and K.J. Sulak. 2005. Further evidence for the invasion and establishment of Pterois volitans (Teleostei: Scorpaenidae) along the Atlantic Coast of the United States. Southeastern Naturalist 4:193-206.
  • Myers R.F. 1991. Micronesian Reef Fishes. Second Edition. Coral Graphics, Barrigada, Guam. 298 p.
  • Ruiz-Carus R., Matheson R.E., Jr., Roberts D.E., Jr., and P.E. Whitfield. 2006. The western Pacific red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and parasitism in the first exotic marine fish established in state waters. Biological Conservation 128:384-390.
  • Sano M., Shimizu, M., and Y. Nose. 1984. Food Habits of Teleostean Reef Fishes in Okinawa Island, Southern Japan. University of Tokyo Press, Japan. 128 p.
  • Schultz E.T. 1986. Pterois volitans and Pterois miles: two valid species. Copeia 1986:686-690.
  • Whitfield P.E., Gardner T., Vives S.P., Gilligan M.R., Coutenay, W.R., Jr., Ray, G.C., and J.A. Hare. 2002. Biological invasion of the Indo-Pacific lionfish Pterois volitans along the Atlantic coast of North America. Marine Ecology Progress Series 235:289-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Embryonic development within the egg masses is evident around 12 hours post-fertilization, and larvae hatch out within around 36 hours of fertilization. The larvae become competent swimmers 2-3 days after hatching, capable of capturing and consuming ciliates and other small zooplankton (Fishelson 1975).The typical larval duration of various lionfish species likely falls in the range of 20-40 days (Whitfield et al. 2002). The congener P. miles is 10-12 mm at when metamorphosing from larva to adult (Fishelson 1975), and the situation is probably similar for P. volitans.
  • Allen G.R., and W.N. Eschmeyer. 1973. Turkeyfishes at Eniwetok. Pac. Disc. 26:3-11.
  • Baker P., Baker S.M., and J. Fajans. 2004. Nonindigenous marine species in the greater Tampa Bay ecosystem. Tampa Bay Estuary Program Technical Publication #02-04. 131p.
  • Courtenay W.R., Jr.. 1995. Marine fish introductions in southeastern Florida. American Fisheries Society Introduced Fish Section Newsletter 14:2-3.
  • Fishelson L. 1975. Ethology and reproduction of pteroid fishes found in the Gulf of Aqaba (Red Sea), especially Dendrochirus brachypterus (Cuvier), (Pteroidae, Teleostei). PSZN 39 (Suppl. 1):635-656.
  • Halstead B.W., Chitwood M.J., and F.R. Modglin 1955. The anatomy of the venom apparatus of the zebrafish Pterois volitans (Linnaeus). The Anatomical Record 122:317-333.
  • Kimball M.E., Miller J.M., Whitfield P.E., and J.A. Hare. 2004. Thermal tolerance and potential distribution of invasive lionfish (Pterois volitans/miles complex) on the east coast of the United States. Marine Ecology Progress Series 283:269-278.
  • Meister H.S., Wyanski D.M, Loefer J.K., Ross S.W., Quattrini A.M., and K.J. Sulak. 2005. Further evidence for the invasion and establishment of Pterois volitans (Teleostei: Scorpaenidae) along the Atlantic Coast of the United States. Southeastern Naturalist 4:193-206.
  • Myers R.F. 1991. Micronesian Reef Fishes. Second Edition. Coral Graphics, Barrigada, Guam. 298 p.
  • Ruiz-Carus R., Matheson R.E., Jr., Roberts D.E., Jr., and P.E. Whitfield. 2006. The western Pacific red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and parasitism in the first exotic marine fish established in state waters. Biological Conservation 128:384-390.
  • Sano M., Shimizu, M., and Y. Nose. 1984. Food Habits of Teleostean Reef Fishes in Okinawa Island, Southern Japan. University of Tokyo Press, Japan. 128 p.
  • Schultz E.T. 1986. Pterois volitans and Pterois miles: two valid species. Copeia 1986:686-690.
  • Whitfield P.E., Gardner T., Vives S.P., Gilligan M.R., Coutenay, W.R., Jr., Ray, G.C., and J.A. Hare. 2002. Biological invasion of the Indo-Pacific lionfish Pterois volitans along the Atlantic coast of North America. Marine Ecology Progress Series 235:289-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pterois volitans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 74
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Pterois volitans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGCATAGTAGGCACAGCCTTGAGCCTGCTTATTCGAGCAGAACTTAGCCAACCGGGCGCTCTATTGGGAGACGACCAAATCTATAATGTAATTGTTACAGCTCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGGGGTTTTGGGAACTGGCTTATCCCGCTGATGATTGGGGCACCAGACATAGCATTTCCTCGTATAAATAACATGAGTTTCTGGCTCCTCCCCCCTTCCTTTCTCCTTCTCCTGGCCTCTTCAGGAGTTGAGGCAGGGGCTGGAACAGGATGAACTGTTTACCCTCCCTTAGCGGGCAATCTTGCCCATGCCGGGGCATCTGTCGACCTAACAATTTTCTCCTTGCACTTAGCAGGCATTTCATCAATCCTGGGGGCAATCAATTTTATTACAACAATTATTAATATAAAACCCCCAGCTATCTCCCAGTACCAAACTCCACTGTTTGTGTGAGCTGTCTTAATTACGGCAGTTCTTTTACTTCTTTCGCTCCCAGTCCTTGCCGCCGGTATTACAATACTGCTTACTGATCGAAACCTCAACACCACCTTCTTTGACCCAGCGGGGGGAGGAGACCCAATTCTTTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 5 specimens with morphological vouchers housed at National Institute of Water and Atmospheric Research, Wellington
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Pterois volitans is not currently listed as threatened or endangered. However, the increase in pollution in coral reefs is expected to kill many of the fish and crustaceans, which lionfish depend on. If lionfish are unable to adjust to these changes by selecting alternate food sources, it is expected that their populations will also decrease (Fishelson, 1997).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

Reefs are in danger, and that means so is the home of the red lionfish!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Pterois volitans is a popular aquarium fish. They are stripped from the wild to make money for the popular pet industry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red lionfish

The red lionfish (Pterois volitans) is a venomous, coral reef fish in the family Scorpaenidae, order Scorpaeniformes. P. volitans is natively found in the Indo-Pacific region, but has become an invasive problem in the Caribbean Sea, as well as along the East Coast of the United States. This and a similar species, Pterois miles have both been deemed as invasive species. Red lionfish are clad in white stripes alternated with red/maroon/brown stripes. Adults in this species can grow as large as 47cm (18.5 inches)[1] in length, while juveniles are typically shorter than 1 inch (2.5 cm).[2] The average red lionfish lives for around 10 years.[3] As with many species within the Scopaenidae family, it has large, venomous spines that protrude from the body, similar to a mane, giving it the common name of the lionfish. The venomous spines make the fish inedible or deter most potential predators. Lionfish reproduce monthly and are able to quickly disperse during their larval stage for expansion of their invasive region. There are no definitive predators of the lionfish, and many organizations are promoting the harvest and consumption of lionfish in efforts to prevent further increases in the already high population densities.

Red lionfish near Gilli Banta Island

Geographic distribution[edit]

P. volitans is native to the Indo-Pacific region,[4] including the western and central Pacific and off the coast of western Australia. However, the species has been accidentally introduced into the Western Atlantic and has become an invasive species there.

Life history and behavior[edit]

Reproduction[edit]

They are mainly a solitary species and courting is the only time they aggregate, generally one male with several females.[3] Both P. volitans and P. miles are gonochoristic, only showing sexual dimorphism during reproduction. Similar courtship behaviors are observed in all Pterois species, including circling, sidewinding, following, and leading. The lionfish are mostly nocturnal, leading to the behaviors typically around nightfall and continuing through the night. After courtship, the female releases two egg masses that are fertilized by the male before floating to the surface.

Early life history and dispersal[edit]

Although little is known about the larval stage of the lionfish, some traits of the larvae include a large head, a long, triangular snout, long, serrated head spines, a larve pelvic spine, and coloration only in the pelvic fins. Larvae hatch 36 hours after fertilization.[3] They are good swimmers and can eat small ciliates just four days after conception.[3] The larval stage is the shortest stage of the lionfish’s life, with a duration of about one month.[5]

Venom[edit]

Lionfish venomous dorsal spines are used purely for defense. When threatened, the fish often faces its attacker in an upside-down posture which brings its spines to bear. However, its sting is usually not fatal to humans. If a human is envenomed, that person will experience extreme pain, and possibly headaches, vomiting, and breathing difficulties. A common treatment is soaking the afflicted area in hot water, as very few hospitals carry specific treatments.[6][7][8] However, immediate emergency medical treatment is still advised, as some people are more susceptible to the venom than others.

As an invasive species[edit]

Main article: Pterois

Two of the 15 species of Pterois, P. volitans and P. miles, have established themselves as significant invasive species off the East Coast of the United States and in the Caribbean. About 93% of the invasive lionfish population is P. volitans, also known as the red lionfish.[9] The red lionfish is found off the East Coast of the United States and the Caribbean Sea, and was likely first introduced off the Florida coast in the early to mid-1990s.[10] Adult lionfish specimens are now found along the US East Coast from Cape Hatteras, North Carolina, to Florida, and in Bermuda, the Bahamas, and throughout the Caribbean, including the Turks and Caicos, Haiti, Cuba, Dominican Republic, Puerto Rico, St. Croix, Belize, Honduras, Aruba and Mexico.[11]

Predators and prey[edit]

In its invasive range, few predators of the lion fish have been documented. Most larger Atlantic and Caribbean fish and sharks that should be able to eat the lionfish have not recognized them as prey, likely due to the novelty of the fish in the invaded areas. Lionfish have, however, been found in the stomachs of Nassau and tiger groupers in the Bahamas.[12] The lionfish themselves are voracious feeders and have outcompeted and filled the niche of the overfished snapper and grouper. When hunting, they corner prey using their large fins, then use their quick reflexes to swallow the prey whole. They hunt primarily from late afternoon to dawn. High rates of prey consumption, a wide variety of prey, and increasing abundance of the fish lead to concerns the fish may have a very active role in the already declining trend of fish densities.[13] As the fish become more abundant, they are becoming a threat to the fragile ecosystems they have invaded. Between outcompeting similar fish and having a varied diet, the lionfish is drastically changing and disrupting the food chains holding the marine ecosystems together. As these chains are disrupted, declining densities of other fish populations are found, as well as declines in the overall diversity of coral reef areas.

References[edit]

  1. ^ [1]
  2. ^ National Oceanic and Atmospheric Administration, National Centers for Coastal Ocean Science "Have You Seen Me?"
  3. ^ a b c d Encyclopedia of Life (EOL). (2011, January 19). Retrieved 4 May 2011 from (http://eol.org)
  4. ^ Lougher, Tristan (2006). What Fish?: A Buyer's Guide to Marine Fish. Interpet Publishing. p. 197. ISBN 0-7641-3256-3. "Where is it from? Eastern Indian Ocean and the Pacific Ocean." 
  5. ^ Leis, J.M. and D.S. Rennis. 2000. Scorpaenidae. An Identification Guide to marine fish larvae. 217-255.
  6. ^ Aldred B, Erickson T, Lipscomb J (November 1996). "Lionfish envenomations in an urban wilderness". Wilderness Environ Med 7 (4): 291–6. doi:10.1580/1080-6032(1996)007[0291:LEIAUW]2.3.CO;2. PMID 11990126. 
  7. ^ Taylor, G. (2000). "Toxic fish spine injury: Lessons from 11 years experience". South Pacific Underwater Medicine Society journal 30 (1). ISSN 0813-1988. OCLC 16986801. Retrieved 2008-08-13. 
  8. ^ Vetrano SJ, Lebowitz JB, Marcus S (November 2002). "Lionfish envenomation". J Emerg Med 23 (4): 379–82. doi:10.1016/S0736-4679(02)00572-3. PMID 12480019. Retrieved 2008-08-13. 
  9. ^ Hamner, R.M, et al. 2007. Mitochondrial cytochrome b analysis reveals two invasive lionfish species with strong founder effects in the western Atlantic. Journal of Fish Biology. 71:214-222.
  10. ^ Whitfield, P; Gardner, T; Vives, SP; Gilligan, MR; Courtney Jr, WR; Ray, GC; Hare, JA (2003). "The Introduction and Dispersal of the Indo-Pacific Lionfish (Pterois volitans) Along the Atlantic Coast of North America". In: SF Norton (ed). Diving for Science...2003. Proceedings of the American Academy of Underwater Sciences (22nd Annual Scientific Diving Symposium). Retrieved 2008-08-13. 
  11. ^ Whitfield PE, Hare J a, David AW, et al. Abundance estimates of the Indo-Pacific lionfish Pterois volitans/miles complex in the Western North Atlantic. Biological Invasions. 2006;9(1):53-64. Available at: http://www.springerlink.com/index/10.1007/s10530-006-9005-9
  12. ^ Maljkovic, A., et al. 2008. Predation on the invasive red lionfish, Pterois volitans, by native groupers in the Bahamas. Coral Reefs 27:501.
  13. ^ Cote, I.M., A. Maljkovie. 2010. Predation rates of Indo-Pacific lionfish on Bahamian coral reefs. Marine Ecology Progress Series 404:219-225.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!