Overview

Comprehensive Description

Biology

A common inshore bottom shark found on coral reefs, often in tide pools (Ref. 247). Probably feeds on bottom invertebrates and small fish (Ref. 6871). Oviparous (Ref. 50449). Can survive up to 12 hours out of water (Ref. 247). Gills sometimes infested by larval isopods (Praniza-larva of isopod Gnathia) (Ref. 247). Utilized as food (Ref. 247); for its meat and fins. Caught frequently by demersal gillnet, longline and trawl fisheries operating in insular and continental shelf waters (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: India, Thailand, Malaysia, Singapore, Indonesia, Viet Nam, China, Taiwan, Japan, Philippines, and northern Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Little is know about the populations of this species. Compagno (2001) reports that it was seen in large numbers at a fish market at Samut, near Bangkok, Thailand. Blaber, Brewer and Harris (1994) report the occurrence of the species in a trawl survey of the Gulf of Carpentaria, Australia, but it was recorded as one of the least abundant species of fish caught. It is encountered reasonably often on the reef flats in the Capricorn-Bunker group, Great Barrier Reef, Queensland, Australia, and in Moreton Bay, Queensland. It has been seen in groups of up to a dozen individuals at specific locations in Moreton Bay that provide protection/cover in otherwise open environments (M.B. Bennet, pers. obs.). It is not uncommon to catch this species when bottom bait-fishing in Moreton Bay, suggesting that it is present in reasonable numbers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

FAO fishing area 51, FAO fishing area 57, FAO fishing area 61, FAO fishing area 71, Jakarta
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=138597 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1040 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

121 cm TL (male/unsexed; (Ref. 58048))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Genus: Nostrils subterminal on snout; pre-oral snout long, mouth closer to eyes than snout tip; eyes and supraorbital ridges hardly elevated; no black hood on head or large spot or spots on sides of body above pectoral fins (Ref. 43278). Caudal fin with a pronounced subterminal notch but without a ventral lobe (Ref. 13575). Species: Young with dark transverse bands and usually a scattering of a few dark spots, bars not prominently edged with black (Ref. 13575, 43278). Adults light-brown, usually without a color pattern (Ref. 13575). Dorsal fins larger than pelvic fins, with projecting free rear tips (Ref. 13575). Body without lateral dermal ridge (Ref. 4832,43278, 13575).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 85 m (Ref. 43278)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Found on coral reefs, on sand and sand/mud substrates throughout its range. Probably occurs on soft substrates in deeper water, to at least 85 m. The species is extremely hardy and can tolerate severe environmental hypoxia, a trait that allows it to occupy and survive in environments that undergo cyclical hypoxic conditions (e.g., coral reef flats). Oviparous species. Hatches at 13 to 17 cm total length (TL) and attains a maximum adult size of about 118 cm TL (M. B. Bennet pers. obs.). Males mature at 68 to 76 cm TL, females at about 63 cm TL (Compagno 2001). Small individuals hide in crevices and among coral and are well camouflaged with their broad banding pattern. Feeds on benthic organisms and small fishes. In Moreton Bay the diet comprises crabs, polychaete worms, shrimps and small teleost fishes (M.B. Bennet pers. obs).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 9.81369 - 185.5
  Temperature range (°C): 15.555 - 28.080
  Nitrate (umol/L): 0.154 - 3.015
  Salinity (PPS): 33.366 - 35.513
  Oxygen (ml/l): 3.884 - 5.336
  Phosphate (umol/l): 0.083 - 0.417
  Silicate (umol/l): 0.777 - 6.815

Graphical representation

Depth range (m): 9.81369 - 185.5

Temperature range (°C): 15.555 - 28.080

Nitrate (umol/L): 0.154 - 3.015

Salinity (PPS): 33.366 - 35.513

Oxygen (ml/l): 3.884 - 5.336

Phosphate (umol/l): 0.083 - 0.417

Silicate (umol/l): 0.777 - 6.815
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A common inshore bottom shark found on coral reefs, often in tidepools. Probably feeds on bottom invertebrates and small fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, with rounded egg cases (Ref. 247). Paired eggs are laid. Embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chiloscyllium punctatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTAATCGTTGACTATTTTCTACAAACCACAAAGACATCGGCACCCTCTACTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTATAGCTCTTAGCCTTTTAATCCGCGCTGAATTAAGTCAACCTGGATCCCTTCTAGGTGATGATCAGATTTATAATGTAATCGTAACAGCCCATGCTTTTGTAATAATTTTCTTTATAGTAATGCCTGTAATAATTGGTGGATTTGGAAATTGACTAGTACCCCTAATAATTGGTGCGCCTGATATAGCCTTTCCTCGAATAAATAATATAAGCTTTTGATTACTTCCTCCTTCATTCCTATTACTTTTAGCCTCTGCAGGAGTTGAAGCCGGAGCAGGAACAGGGTGAACTGTTTACCCACCTTTAGCAGGTAATTTAGCCCACGCAGGAGCATCAGTTGATTTAACTATTTTCTCCTTACACTTAGCAGGAATTTCATCAATCCTAGCCTCTATCAATTTCATCACAACCATTATCAATATAAAACCACCAGCCATTTCTCAATATCAAACACCCTTATTTGTATGATCAATTCTTGTAACTACCATCCTTCTACTTCTTTCATTACCAGTTCTAGCAGCAGGTATTACTATATTACTTACAGATCGAAACCTAAATACAACATTCTTTGATCCAGCAGGAGGAGGCGATCCTATTTTATATCAACACCTATTCTGATTTTTCGGACATCCAGAAGTATATATCCTAATTCTCCCAGGATTTGGTATAATTTCACATGTAGTTGCTTACTATTCAGGTAAAAAAGAACCTTTCGGTTATATAGGAATAGTATGAGCAATAATAGCAATTGGCCTATTAGGTTTTATTGTATGAGCCCATCACATATTTACAGTAGGAATAGACGTTGATACACGAGCTTACTTTACATCTGCAACAATAATTATTGCAATTCCCACAGGCGTTAAAGTATTTAGCTGATTAGCAACACTTCACGGAGGCTCAATTAAATGAGAAACACCATTATTATGAGCCCTAGGCTTTATTTTTCTATTTACTGTTGGAGGCCTAACAGGAATTGTATTAGCTAACTCATCATTAGATATTGTACTCCACGACACTTATTATGTAGTAGCCCACTTCCACTACGTTCTTTCTATAGGAGCAGTTTTTGCCATTATAGCAGGATTTATTCACTGATTCCCACTAATATCAGGCTTTACCTTACACTCTACCTGAACAAAAATCCAATTTATCTTAATATTCATCGGAGTAAATTTAACTTTCTTCCCACAACACTTCCTCGGACTCGCTGGAATACCACGACGATATTCAGACTATCCTGACGCTTATACCCTATGAAATGCAATTTCTTCAATCGGCTCATTAATTTCATTAGTAGCAGTAATTTTATTATTATTTATTATCTGAGAAGCATTCGCTTCCAAACGAGAAGTATTGTCTATTGAACTTCCACACACAAATGTAGAGTGACTCCACGGATGTCCTCCTCCATACCATACATATGAAGAACCCGCTTTCGTTCAAGTTCAACAAACTTCATTTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chiloscyllium punctatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Bennett, M.B. & Kyne, P.M. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Fowler, S. & Cavanagh, R.D. (Shark Red List Authority)

Justification
Chiloscyllium punctatum is a widely distributed and probably fecund (oviparous) tropical species occurring in a variety of habitats throughout its range. Within Australia the species is assessed as Least Concern as a portion of its habitat is protected in marine parks and it is not a target species, except perhaps for the aquarium trade. It is an extremely hardy species that would presumably survive as a discard in any trawl bycatch. However, throughout much of the rest of its range, the species is likely to be threatened by overfishing for human consumption, habitat loss due to destructive fishing methods on coral reefs, and collection for the display-aquarium trade. It fails to meet the criteria for Vulnerable due to insufficient data, but is assessed as Near Threatened globally because of concern over the significant impact that these practices must be having on this species in much of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Widespread collection for human consumption in artisanal and commercial fisheries and habitat damage over much of its range (not Australia) are the major threats to this species. Collection for the aquarium trade is a minor threat, especially as the species is hardy and will breed prolifically in captivity. Inshore seine-netting, trap fishing and bait fishing are probably the primary modes of collection. Damage and destruction of coral reef habitat from dynamite fishing, other destructive fishing practices and pollution are known to be widespread in large parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is protected in a significant proportion of its range on the east coast of Australia in the Great Barrier Reef Marine Park and the Moreton Bay Marine Park. While fishing is still allowed in most areas of the parks, the species is not targeted and is likely to survive capture as bycatch.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brownbanded bamboo shark

Juvenile

The brownbanded bamboo shark, Chiloscyllium punctatum, is a bamboo shark in the family Hemiscylliidae found in the Indo-West Pacific from Japan to northern Australia, between latitudes 34° N and 26° S, to depths of 85 metres (279 ft). Its length is up to 1.04 metres (41 in). While adults are overall brownish with faint suggestions of bands, the commonly seen juveniles are distinctly barred dark and pale.

Classified as Near Threatened (NT) on the IUCN Red List [1]

Its minimum population doubling is 4.5–14 years range.[2] The major threats to these sharks are the loss of their habitat, pollution, and hunting (both for aquarium trade as well as food).[3]

Reproduction is oviparous.

It is regularly bred in public aquaria, and is arguably the shark most suited to aquaria.

Contents

Features

Concave posterior margined dorsal fin. No color patterns for the adults but the juveniles have dark transverse bands with some dark spots.[4]

These sharks are nocturnal animals and can survive out of the water for up to 12 hrs. These sharks have barbels, which are sensory organs that look like whiskers. Hence the common name for these sharks is “Cat shark” [5]

Habitat

These sharks live around coral reefs and tide pools.

Sharks as pets

The minimum size of the tank that can carry an adult cat shark is about 180 gallons. Because these sharks are nocturnal species they will need some type of shaded area within the tank where the shark could hide. Although these sharks do not swim around too much, it is highly suggested that the items within the tank should be stable; cat sharks are very strong and will knock down anything that’s not stable inside the tank. Also this shark should not be placed with Triggers and Puffers, they will nip at the shark’s fins, nor should they be placed with aggressive feeders.[6]

Feeding

These sharks are carnivores that should be fed 2-3 times a week; some of their diet includes fresh shrimp, scallop, squid, and marine fish. Along with the food, these sharks should take some iodine supplements to prevent goiter disease. Two things to be aware of when feeding the shark: one is to make sure that the meals are bite-sized or else it will throw it back up and the second is sometimes juveniles are difficult to get to eat so adding a flavor enhances their interest.[7]

See also

References

  1. ^ Unknown, . "Chiloscyllium punctatum." International Union for Conservation of Nature and Natural Resources. N.p., 2010. Web. 15 April 2010. <http://www.iucnredlist.org/apps/redlist/details/41872/0/>.<
  2. ^ Unknown, . "Cat shark – Chiloscyllium punctatum." Aquatic community. N.p., 2008. Web. 27 April 2010. <http://www.aquaticcommunity.com/sharkfish/catshark.php>.
  3. ^ Unknown, . "Chiloscyllium punctatum." International Union for Conservation of Nature and Natural Resources. N.p., 2010. Web. 15 April 2010. <http://www.iucnredlist.org/apps/redlist/details/41872/0/>.
  4. ^ Compagno, Leonard. "Sharks of the world." Shark Research Center Iziko-Museums of Cape Town. NO. 1. Vol 2. Cape Town South Africa: FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS, 2002. Pg 160-195
  5. ^ Unknown, . "Banded Cat Shark (Brownbanded Bamboo Shark)." Animal-World. N.p., 2010. Web. 15 April 2010. <http://animal-world.com/encyclo/marine/sharks_rays/information/BandedBambooSharkArticle.php>.
  6. ^ Unknown, . "Cat shark – Chiloscyllium punctatum." Aquatic community. N.p., 2008. Web. 15 April 2010. <http://www.aquaticcommunity.com/sharkfish/catshark.php>.
  7. ^ Unknown, . "Cat shark – Chiloscyllium punctatum." Aquatic community. N.p., 2008. Web. 15 April 2010. <http://www.aquaticcommunity.com/sharkfish/catshark.php>.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!