You are viewing this Taxon as classified by:

Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A common inshore bottom shark found on coral reefs, often in tide pools (Ref. 247). Probably feeds on bottom invertebrates and small fish (Ref. 6871). Oviparous (Ref. 50449). Can survive up to 12 hours out of water (Ref. 247). Gills sometimes infested by larval isopods (Praniza-larva of isopod Gnathia) (Ref. 247). Utilized as food (Ref. 247); for its meat and fins. Caught frequently by demersal gillnet, longline and trawl fisheries operating in insular and continental shelf waters (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Andaman Island and India east to Philippines, north to Japan and south to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1040 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

121 cm TL (male/unsexed; (Ref. 58048))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Genus: Nostrils subterminal on snout; pre-oral snout long, mouth closer to eyes than snout tip; eyes and supraorbital ridges hardly elevated; no black hood on head or large spot or spots on sides of body above pectoral fins (Ref. 43278). Caudal fin with a pronounced subterminal notch but without a ventral lobe (Ref. 13575). Species: Young with dark transverse bands and usually a scattering of a few dark spots, bars not prominently edged with black (Ref. 13575, 43278). Adults light-brown, usually without a color pattern (Ref. 13575). Dorsal fins larger than pelvic fins, with projecting free rear tips (Ref. 13575). Body without lateral dermal ridge (Ref. 4832,43278, 13575).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 9.81369 - 185.5
  Temperature range (°C): 15.555 - 28.080
  Nitrate (umol/L): 0.154 - 3.015
  Salinity (PPS): 33.366 - 35.513
  Oxygen (ml/l): 3.884 - 5.336
  Phosphate (umol/l): 0.083 - 0.417
  Silicate (umol/l): 0.777 - 6.815

Graphical representation

Depth range (m): 9.81369 - 185.5

Temperature range (°C): 15.555 - 28.080

Nitrate (umol/L): 0.154 - 3.015

Salinity (PPS): 33.366 - 35.513

Oxygen (ml/l): 3.884 - 5.336

Phosphate (umol/l): 0.083 - 0.417

Silicate (umol/l): 0.777 - 6.815
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 85 m (Ref. 43278)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 9.81369 - 185.5
  Temperature range (°C): 15.555 - 28.080
  Nitrate (umol/L): 0.154 - 3.015
  Salinity (PPS): 33.366 - 35.513
  Oxygen (ml/l): 3.884 - 5.336
  Phosphate (umol/l): 0.083 - 0.417
  Silicate (umol/l): 0.777 - 6.815

Graphical representation

Depth range (m): 9.81369 - 185.5

Temperature range (°C): 15.555 - 28.080

Nitrate (umol/L): 0.154 - 3.015

Salinity (PPS): 33.366 - 35.513

Oxygen (ml/l): 3.884 - 5.336

Phosphate (umol/l): 0.083 - 0.417

Silicate (umol/l): 0.777 - 6.815
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A common inshore bottom shark found on coral reefs, often in tidepools. Probably feeds on bottom invertebrates and small fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, with rounded egg cases (Ref. 247). Paired eggs are laid. Embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chiloscyllium punctatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTAATCGTTGACTATTTTCTACAAACCACAAAGACATCGGCACCCTCTACTTAATCTTTGGTGCATGAGCAGGAATAGTAGGTATAGCTCTTAGCCTTTTAATCCGCGCTGAATTAAGTCAACCTGGATCCCTTCTAGGTGATGATCAGATTTATAATGTAATCGTAACAGCCCATGCTTTTGTAATAATTTTCTTTATAGTAATGCCTGTAATAATTGGTGGATTTGGAAATTGACTAGTACCCCTAATAATTGGTGCGCCTGATATAGCCTTTCCTCGAATAAATAATATAAGCTTTTGATTACTTCCTCCTTCATTCCTATTACTTTTAGCCTCTGCAGGAGTTGAAGCCGGAGCAGGAACAGGGTGAACTGTTTACCCACCTTTAGCAGGTAATTTAGCCCACGCAGGAGCATCAGTTGATTTAACTATTTTCTCCTTACACTTAGCAGGAATTTCATCAATCCTAGCCTCTATCAATTTCATCACAACCATTATCAATATAAAACCACCAGCCATTTCTCAATATCAAACACCCTTATTTGTATGATCAATTCTTGTAACTACCATCCTTCTACTTCTTTCATTACCAGTTCTAGCAGCAGGTATTACTATATTACTTACAGATCGAAACCTAAATACAACATTCTTTGATCCAGCAGGAGGAGGCGATCCTATTTTATATCAACACCTATTCTGATTTTTCGGACATCCAGAAGTATATATCCTAATTCTCCCAGGATTTGGTATAATTTCACATGTAGTTGCTTACTATTCAGGTAAAAAAGAACCTTTCGGTTATATAGGAATAGTATGAGCAATAATAGCAATTGGCCTATTAGGTTTTATTGTATGAGCCCATCACATATTTACAGTAGGAATAGACGTTGATACACGAGCTTACTTTACATCTGCAACAATAATTATTGCAATTCCCACAGGCGTTAAAGTATTTAGCTGATTAGCAACACTTCACGGAGGCTCAATTAAATGAGAAACACCATTATTATGAGCCCTAGGCTTTATTTTTCTATTTACTGTTGGAGGCCTAACAGGAATTGTATTAGCTAACTCATCATTAGATATTGTACTCCACGACACTTATTATGTAGTAGCCCACTTCCACTACGTTCTTTCTATAGGAGCAGTTTTTGCCATTATAGCAGGATTTATTCACTGATTCCCACTAATATCAGGCTTTACCTTACACTCTACCTGAACAAAAATCCAATTTATCTTAATATTCATCGGAGTAAATTTAACTTTCTTCCCACAACACTTCCTCGGACTCGCTGGAATACCACGACGATATTCAGACTATCCTGACGCTTATACCCTATGAAATGCAATTTCTTCAATCGGCTCATTAATTTCATTAGTAGCAGTAATTTTATTATTATTTATTATCTGAGAAGCATTCGCTTCCAAACGAGAAGTATTGTCTATTGAACTTCCACACACAAATGTAGAGTGACTCCACGGATGTCCTCCTCCATACCATACATATGAAGAACCCGCTTTCGTTCAAGTTCAACAAACTTCATTTTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chiloscyllium punctatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brownbanded bamboo shark

The brownbanded bamboo shark, Chiloscyllium punctatum, is a bamboo shark in the family Hemiscylliidae found in the Indo-West Pacific from Japan to northern Australia, between latitudes 34° N and 26° S, to depths of 85 metres (279 ft). Its length is up to 1.04 metres (41 in). While adults are overall brownish with faint suggestions of bands, the commonly seen juveniles are distinctly barred dark and pale.

Classified as Near Threatened (NT) on the IUCN Red List [1]

Its minimum population doubling is 4.5–14 years range.[2] The major threats to these sharks are the loss of their habitat, pollution, and hunting (both for aquarium trade as well as food).[3]

Reproduction is oviparous.

It is regularly bred in public aquaria, and is arguably the shark most suited to aquaria.

Features[edit]

Juvenile

Concave posterior margined dorsal fin. No color patterns for the adults but the juveniles have dark transverse bands with some dark spots.[4]

These sharks are nocturnal animals and can survive out of the water for up to 12 hrs. These sharks have barbels, which are sensory organs that look like whiskers. Hence the common name for these sharks is “Cat shark” [5]

Habitat[edit]

These sharks live around coral reefs and tide pools.

Sharks as pets[edit]

The minimum size of the tank that can carry an adult cat shark is about 180 gallons. Because these sharks are nocturnal species they will need some type of shaded area within the tank where the shark could hide. Although these sharks do not swim around too much, it is highly suggested that the items within the tank should be stable; cat sharks are very strong and will knock down anything that is not stable inside the tank. Also this shark should not be placed with Triggers and Puffers, they will nip at the shark’s fins, nor should they be placed with aggressive feeders.[6]

Feeding[edit]

These sharks are carnivores that should be fed 2-3 times a week; some of their diet includes fresh shrimp, scallop, squid, and marine fish. Along with the food, these sharks should take some iodine supplements to prevent goiter disease. Two things to be aware of when feeding the shark: one is to make sure that the meals are bite-sized or else it will throw it back up and the second is sometimes juveniles are difficult to get to eat so adding a flavor enhances their interest.[7]

See also[edit]

References[edit]

  1. ^ Unknown, . "Chiloscyllium punctatum." International Union for Conservation of Nature and Natural Resources. N.p., 2010. Web. 15 April 2010. <http://www.iucnredlist.org/apps/redlist/details/41872/0/>.<
  2. ^ Unknown, . "Cat shark – Chiloscyllium punctatum." Aquatic community. N.p., 2008. Web. 27 April 2010. <http://www.aquaticcommunity.com/sharkfish/catshark.php>.
  3. ^ Unknown, . "Chiloscyllium punctatum." International Union for Conservation of Nature and Natural Resources. N.p., 2010. Web. 15 April 2010. <http://www.iucnredlist.org/apps/redlist/details/41872/0/>.
  4. ^ Compagno, Leonard. "Sharks of the world." Shark Research Center Iziko-Museums of Cape Town. NO. 1. Vol 2. Cape Town South Africa: FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS, 2002. Pg 160-195
  5. ^ Unknown, . "Banded Cat Shark (Brownbanded Bamboo Shark)." Animal-World. N.p., 2010. Web. 15 April 2010. <http://animal-world.com/encyclo/marine/sharks_rays/information/BandedBambooSharkArticle.php>.
  6. ^ Unknown, . "Cat shark – Chiloscyllium punctatum." Aquatic community. N.p., 2008. Web. 15 April 2010. <http://www.aquaticcommunity.com/sharkfish/catshark.php>.
  7. ^ Unknown, . "Cat shark – Chiloscyllium punctatum." Aquatic community. N.p., 2008. Web. 15 April 2010. <http://www.aquaticcommunity.com/sharkfish/catshark.php>.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!