Overview

Comprehensive Description

Biology

Found in coastal and offshore waters but not oceanic (Ref. 5578). Adults are commonly found at depths of 200-400 m, young in shallower waters (Ref. 5485). A seasonal migratory species over parts of its range (Ref. 6871). Common component of the catch of the shark longline fishery (Ref.58048). Feeds on bottom and pelagic bony fish, sharks, skates, rays, cephalopods, gastropods, crustaceans, sometimes mammalian carrion and inorganic objects (Ref. 5578). Viviparous (Ref. 50449). Large adults are potentially dangerous (Ref. 4716, 6871). Utilized fresh, dried-salted, frozen and smoked for human consumption; hides for leather; fins for sharks-fin soup; and liver oil extracted for vitamins (Ref. 244).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: shark (English), tiburón (Espanol)
 
Carcharhinus obscurus (Lesueur, 1818)


Dusky shark



Body moderately slender to moderately stout;  snout moderately short, broad, rounded, length 1-1.4 in distance between nostrils; nasal flaps rudimentary;  upper front teeth broadly triangular, straight to a little oblique, serrated; lower front teeth with low, narrow, serrated points; low ridge on back between dorsal fins; origin of first dorsal fin over or slightly behind free rear corner of pectoral fins; first dorsal fin relatively low (height 6-9.1% of TL),  front edge broadly arched, tip pointed to narrowly rounded; origin of second dorsal above anal fin origin, with long free rear tip; pectoral long, curved, pointed tip.


Very similar in appearance and easily confused with  C. galapagensis;  best means of separation is the lower dorsal fin: 5.8-9.9 % of TL in C. obscurus  vs 9.1-12.1% of TL in C. galapagensis.


Grey, shading to white ventrally, with a faint, near-horizontal, grey band invading the white of upper abdomen; tips of fins dusky.

Size: reaches 420 cm; size at birth 69-100 cm.

Habitat: Inshore to offshore coastal- pelagic, primarily on continental shelves, not in low salinity habitats.

Depth: 0-400 m.

Circumglobal in tropical and warm temperate seas; from California to the Gulf of California and central Mexico, and the Revillagigedos.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Djibouti, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Israeli part of the Mediterranean Sea - Eastern Basin, Madagascar, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, Red Sea, South Africa (country), Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: southern Massachusetts to Florida (USA), Georges Bank, Bahamas, Cuba, northern Gulf of Mexico, Nicaragua, southern Brazil and Uruguay (Ref. 58839). Eastern Atlantic: Canary Islands, Cape Verde, Senegal, Sierra Leone. Some records from the Mediterranean and Madeira may be based on Carcharhinus galapagensis. Indo-West Pacific: Red Sea (Ref. 5485), Mozambique and South Africa to Japan, China, Viet Nam and Australia. Eastern Pacific: southern California, USA to Gulf of California and the Revillagigedo Island. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Dusky Shark has a cosmopolitan but patchy distribution in tropical and warm temperate seas (Last and Stevens 1994).

Western Atlantic: Southern Massachusetts and Georges Bank to Florida, Bahamas, Cuba, northern Gulf of Mexico, and Nicaragua, southern Brazil (Compagno in prep., Last and Stevens 1994).

Eastern Atlantic: This shark?s distribution is uncertain in the northeast and eastern central Atlantic and these records, and others from tropical insular areas, may be misidentifications of C. galapagensis (J. Musick pers. comm.). It has been recorded from Canary and Cape Verde Islands, Senegal and Sierra Leone. Uncertain records exist from elsewhere, including Portugal, Spain, Morocco and Madeira (Compagno in prep., Last and Stevens 1994).

Mediterranean Sea: Most records are from the western and central-southern regions, along the North African coasts and Sicily Straits. It is likely that this species? ranges further east in the Ionian Sea and Levantine Basin (Fergusson and Compagno 2000). Around 20 specimens have been recorded in the Mediterranean Sea to date: after Lozano Rey?s first record for the Mediterranean (1928), Moreno (1982) cites three specimens from the Alboran Sea and Hemida and Labidi (2002) reported another three from eastern Algeria. A single Tunisian report is from Capapé et al. (1979) and similarly, one from Malta (Fergusson and Compagno 2000). At Mazara del Vallo, Sicily, a further three specimens were observed (Cigala-Fulgosi pers. comm. in Fergusson and Compagno 2000) and Vacchi and Serena (1997) observed one. A single specimen was caught at Capo Testa, Sardinia (Fergusson and Compagno 2000) and at least five were seen in Tripoli, Libya, by Trevor Meyer (pers. comm. 2002).

Indian Ocean: South Africa, Mozambique, Madagascar, and possibly in the Red Sea. Also, patchy records scattered in the Arabian Sea and recorded from the Andaman Islands in the Bay of Bengal (Compagno in prep., Last and Stevens 1994).

Western Pacific: Japan, China, Viet Nam, New Caledonia and throughout Australian waters (Compagno in prep., Last and Stevens 1994).

Eastern Pacific: Southern California to Gulf of California, Revillagigedo Islands, and possibly Chile (Compagno in prep., Last and Stevens 1994).

The Dusky Shark undertakes long temperature-related migrations. On both coasts of the U.S., Dusky Sharks migrate northward in summer as the waters warm and retreat southward in fall as water temperatures drop (Musick et al. 1993). In western Australia, adolescents and adults move inshore during the summer and fall, with neonates occupying separate inshore areas (Last and Stevens 1994). Seasonal migrations (north in winter and south in summer) also occur off South Africa (Bass et al. 1973). In the Indian Ocean, the young are known to aggregate in dense assemblages when feeding (Compagno 1984). Nursery areas occur in shallow waters (Compagno in prep.). Off Brazil, Mazzoleni (2000) suggested that there was possibly a nursery area in the north of Santa Catarina State, when 79 neonates were caught by the artisanal fishery from 1994 to 2000. Neonates were abundant in the end of summer to the middle of autumn (February?May). In the winter season virtually no specimens were caught. Nursery areas also occur off the southern coast of Natal, South Africa and off South Carolina, USA (Compagno in prep.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

southern Massachusetts and NE Georges Bank to Florida
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Nearly worldwide but patchy distribution in warm temperate and tropical waters; probably cosmopolitan in warm and temperate continental waters (Castro 1983, Michael 1993). Literature records of distribution include the eastern and western Atlantic, northeastern Pacific, western Indian Ocean off South Africa, Mozambique, Madagascar, and possibly in the Red Sea; western Pacific Ocean from Japan to Australia and New Caledonia (Garrick 1982). Distributed in the Atlantic Ocean from Georges Bank, Cape Cod, Bermuda, and the northern Gulf of Mexico to Brazil (Hoese and Moore 1998). A detailed range description is as follows: western Atlantic as far north as Georges Bank and southward including Massachusetts, New York, New Jersey, Florida (both coasts), British Guiana, Cayenne, and Brazil; eastern Atlantic from the Canary Islands in the north and southwards at Senegal and off Capetown, South Africa, although records from around oceanic islands off western Africa and from other tropical insular areas may be misidentifications of a sibling species (C. galapagensis) (J. Musick, pers. comm.); Red Sea and western Indian Ocean from Suez, the west coast of Madagascar, and the east coast of Africa southward to the tip of South Africa; both west and east coasts of Australia, from Houtmans Abrolhos, Perth, and Baldhead in Western Australia, from Moreton Bay in Queensland, and from Botany Bay in New South Wales; Japan, China, Vietnam; and the eastern North Pacific from southern California to the Gulf of California, Revillagigedo Islands, and possibly Chile (Garrick 1982, Castro 1983, Compagno 1984). Considered rare in the Mediterranean Sea, but the status is scantily known; probably more cosmopolitan in the central Mediterranean; incursions into the Mediterranean from the Atlantic may be solely related to reproduction (The Shark Trust 1998). Uncommon in Bermuda; taken well offshore (Beebe and Tee-van 1933). All captures in the northern part of range have been during the warm months; present year round along eastern Florida but only in the winter off southwestern Florida (Tee-van et al. 1948).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nearly worldwide, tropical and subtropical seas (including western Mediterranean Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: north to southern New England and to Georges Bank, south to southern Brazil. Eastern Atlantic: Canary Islands, Cape Verde, Senegal, Sierra Leone. Migrates seasonally over part of its range.
  • Bigelow, H. B. and Schroeder,W.C.,1953; Compagno, L.J.V., 1984; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989; Bass, A.J., P.C. Heemstra and L.J.V Compagno, 1986 ; Last, P.R. and J.D. Stevens, 1994.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 400 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), West + East Pacific (but not Central), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 420.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 4200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

420 cm TL (male/unsexed; (Ref. 5578)); max. published weight: 346.5 kg (Ref. 4699); max. reported age: 40 years (Ref. 31395)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 420 cm TL; max. weight 374 kg.
  • Bigelow, H. B. and Schroeder,W.C.,1953; Compagno, L.J.V., 1984; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989; Bass, A.J., P.C. Heemstra and L.J.V Compagno, 1986 ; Last, P.R. and J.D. Stevens, 1994.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A large shark with a broadly rounded snout, triangular saw-edged upper teeth, curved moderate-sized pectoral fins, and an interdorsal ridge (Ref. 5578). Blue-grey, lead-grey above, white below; tips of pectoral and pelvic fins, as well as lower lobe of caudal fin and dorsal fins often dusky in young, plain in adults (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found on continental and insular shelves and oceanic waters. Avoids estuaries. Adults are commonly found at depths of 200-400 m, young in shallower waters (Ref. 5485). A seasonal migratory species. Feeds on fish, sharks, rays, squids, gastropods, crustaceans, and detritus. Viviparous; litter size 6-14 pups, usually born early winter; 69-100 cm at birth. Utilized fresh and dried-salted for human consumption; hides for leather; fins for sharks-fin soup; and liver oil extracted for vitamins.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 400 m (Ref. 244), usually 200 - 400 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
C. obscurus is a coastal-pelagic species found inshore and offshore in warm-temperate and tropical waters of the continental and insular shelves and the oceanic waters adjacent to them. The species ranges from close inshore in the surf zone to well out to sea and from the surface to 400 m depth. It does not prefer areas with reduced salinities and tends to avoid estuaries. Adult dusky sharks are often seen offshore and commonly follow ships. This shark is strongly migratory in temperate and subtropical areas in the eastern north Pacific and western north Atlantic, moving north during the warmer months of summer and retreating south when the water cools. Dusky sharks eat a wide variety of reef, bottom, and pelagic bony fishes, as well as other elasmobranchs, crustaceans, octopi, cuttlefish, squid, starfish, barnacles, bryozoans, whale meat, and occasional garbage (Compagno 1984).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The majority of the information below is taken from Camhi et al. (2005).

This shark is coastal and pelagic in its distribution, where it occurs from the surf zone to well offshore, and from the surface to depths of 400 m (Compagno 1984). Because it is poorly adapted to osmoregulate at lower salinities, it is not commonly found in estuaries (Compagno 1984, Musick et al. 1993). A study off Brazil by Motta et al. (1997) recorded the species at depths of 8?15 m off southern Sao Paulo State. Tagging studies in the southwestern Indian Ocean (Davies and Joubert 1967, Bass et al. 1973), the Northwest Atlantic, Gulf of Mexico (Kohler 1996), and the southeastern Indian Ocean (Simpfendorfer unpublished data) have all shown that C. obscurus is a highly migratory species. The longest distance between tagging and recapture is 2,052 nautical miles, and the longest period at liberty 15.8 years. Movements normally show seasonal patterns, with adults moving into more temperate areas as temperatures rise in summer. Movements of adults are longer than those of neonates and juveniles, although juveniles of approximately a year old have been recorded moving as much as 742 nautical miles off South Africa (Dudley et al. 2005). The juveniles are known to migrate down as far as the southern and western Cape when the waters warm up during the summer months. They retreat back to the east coast as it cools (D. Ebert pers. comm. 2004). Major nursery areas for C. obscurus have been identified off the KwaZulu-Natal coast of South Africa (Bass et al. 1973), the New Jersey to South Carolina coast of the United States (Musick and Colvocoresses 1988, Castro 1993), and the southwest coast of Australia (Last and Stevens 1994, Simpfendorfer 1999). The neonates occur in nearshore waters in all of these nursery areas, but do not enter lower salinity areas.

Carcharhinus obscurus is a large shark that reaches >360 cm in length and 180 kg (Castro 1983). Off KwaZulu-Natal a female of 383 cm precaudal length (PL) and 450 kg has been captured in the protective shark nets (Dudley et al. 2005). Maximum sizes recorded in the Mediterranean Sea were a male of 311 cm and a female of 349 cm (Fergusson and Compagno 2000). Size and age data are available from several areas. In the northwest Atlantic, males mature at 231 cm fork length (FL) and at 19 years of age, and females at 235 cm FL and at 21 years of age (Natanson et al. 1995). In the southwest Indian Ocean, off South Africa, Dudley et al. (2005) report that males mature at 210 cm PL and 19.2 years of age and females at 214 cm PL and 20 years of age. The oldest Dusky Shark reported from vertebral ageing studies is 37 years, although they are believed to live to a maximum of 40-50 years (Natanson et al. 1995, Sminkey 1996).

The Dusky Shark is placentally viviparous, with litters normally ranging in size from 3?16 pups, of 70?100 cm (Last and Stevens 1994, Dudley et al. 2005). Recent work has suggested that gestation may be as long as 22 months (Branstetter and Burgess 1996, Dudley et al. 2005, Romine 2004). The lack of large yolky ova in the ovary of late-term pregnant C. obscurus indicates that there is one year resting period between birth and mating, making the reproductive cycle at least three years long (Musick 1995, Branstetter and Burgess 1996, Romine 2004).

Recent demographic analyses of C. obscurus in the western Atlantic have generated estimates of the annual rate of population increase of 2.8% (Cortés 1998) and 5.57% (Sminkey 1996). Both of these estimates are for the population without fishing mortality and assume a two-year reproductive cycle. Given that it is now thought that the reproductive cycle lasts three years these population increase rates are probably lower. Romine (2004) estimated the annual rate of population increase only to be around 1.9% and the population doubling time was estimated to be 36 years. Simpfendorfer (1999), using a three year reproductive cycle, estimated the annual rate of population increase for the Australian population was 4.3%. The low rates of population increase highlight the need for conservative management of fisheries that capture C. obscurus (Cortés 1998).

Diet: Carcharhinus obscurus has a varied diet that includes teleosts, elasmobranchs and cephalopods. Neonates and juveniles mostly consume small pelagic teleosts (e.g., sardines and anchovies) and squid (Smale 1991, Stevens 1990, Simpfendorfer pers. data). With increasing size larger teleosts (e.g., groupers, jacks) and elasmobranchs (e.g., dasyatids Raja spp., Rhinobatus spp., squatinids, carcharhinids, mustelids and squalids) become more important in the diet (Bass et al. 1973, van der Elst 1979, Castro 1983, Smale 1991, Gelshleichter et al. 1998). As a common apex predator C. obscurus plays an important (but poorly studied) role in the marine ecosystem. In the western Atlantic, the dusky has always been less abundant than some other species of carcharhinid sharks with which it is sympatric, such as the sandbar shark (Musick et al. 1993). This seems to be in keeping with its larger size and higher trophic position.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 111 specimens in 1 taxon.
Water temperature and chemistry ranges based on 69 samples.

Environmental ranges
  Depth range (m): 7 - 4575
  Temperature range (°C): 4.176 - 24.665
  Nitrate (umol/L): 0.289 - 27.201
  Salinity (PPS): 33.239 - 36.472
  Oxygen (ml/l): 3.453 - 6.300
  Phosphate (umol/l): 0.106 - 1.731
  Silicate (umol/l): 1.010 - 28.164

Graphical representation

Depth range (m): 7 - 4575

Temperature range (°C): 4.176 - 24.665

Nitrate (umol/L): 0.289 - 27.201

Salinity (PPS): 33.239 - 36.472

Oxygen (ml/l): 3.453 - 6.300

Phosphate (umol/l): 0.106 - 1.731

Silicate (umol/l): 1.010 - 28.164
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Generally occurs along continental coastlines in tropical and temperate regions (Garrick 1982); coastal and pelagic, from inshore waters to the outer reaches of the continental shelf (Castro 1983); apparently avoids areas of lower salinities, so not commonly found in estuaries (Compagno 1984; Musick et al. 1993). Enters shallow water, but more pelagic and temperate than bull shark and sandbar shark (Robins et al. 1986). Historically recorded near rocks, pilings, seawalls, seagrass beds, and offshore waters in south Florida (Starck 1968, Voss et al. 1969). Usually slow moving, with a depth range from the intertidal zone to 400 m (Compagno 1984, Schwartz and Jensen 1996). Uses specific geographical areas for nursery grounds. As individuals grow, they move into deeper water (Michael 1993). Nursery grounds appear to be surf zone areas, but do not include embayments or low salinity areas (Branstetter 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 400m.
Recorded at 400 meters.

Habitat: pelagic. Dusky shark.  Lesueur, 1818 Attains 3.5 Metres. Litter contains 6 - 14 pups born early winter at 80-90 cms. Has been blamed for at least 2 attacks on man.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Marine pelagic and brackish waters, coastal and offshore waters. Adults at depths of 200-400 m, young in more shallow waters
  • Bigelow, H. B. and Schroeder,W.C.,1953; Compagno, L.J.V., 1984; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989; Bass, A.J., P.C. Heemstra and L.J.V Compagno, 1986 ; Last, P.R. and J.D. Stevens, 1994.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Surface, Near Surface, Mid Water, Near Bottom, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

This shark makes long, temperature-related migrations. On both coasts of the U.S., dusky sharks migrate northward in summer as the waters warm and retreat southward in fall as water temperatures drop (Castro 1983). Off South Afrcia, similar seasonal migrations occur, though the movement is north in winter and south in summer (Bass et al. 1973). In western Australia, adolescents and adults move inshore during the summer and fall, with neonates occupying separate inshore areas (Last and Stevens 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf and slope (Ref. 75154). Dusky whales tend to avoid estuaries and areas of low salinity (Refs. 244, 6390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds upon flatfishes, groupers, jacks, other sharks, invertebrates, and numerous reef fishes (Castro 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on bottom and pelagic bony fish, sharks, skates, rays, cephalopods, gastropods, crustaceans, sometimes mammalian carrion.
  • Bigelow, H. B. and Schroeder,W.C.,1953; Compagno, L.J.V., 1984; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989; Bass, A.J., P.C. Heemstra and L.J.V Compagno, 1986 ; Last, P.R. and J.D. Stevens, 1994.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, sea-stars/cucumbers/urchins, bony fishes, sharks/rays
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Exact number of occurrences is unknown but may be large given the circumtropical range of the species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Global abundance is unknown. Cited as a historically frequent species in offshore waters of the Florida Keys (Starck 1968). Not common off oceanic islands, but at least historically prevalent off continental coastlines in tropical and temperate regions (Garrick 1982, Castro 1983). Characterized as a large, common shark of continental shelf and insular regions (Branstetter 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Causes of mortality in large sharks are poorly known because they traditionally had low commercial value and are often difficult to obtain for study (Hoenig and Walsh 1983). Mortality rates on young may be high because of predation from other sharks, most notably blacktip and sand tiger sharks (Branstetter 1990).

In the Indian Ocean, the young are known to aggregate in dense assemblages when feeding (Compagno 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, with a yolk-sac placenta, litter size 3-14 pups (Ref. 244); 70-100 cm at birth (Ref. 6871). Gestation period of ~ 16 months (Ref.58048). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 35 years (wild) Observations: Unverified estimates suggest these animals may live up to 40 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Development is viviparous. The gestation period is believed to be about 12-16 months or even longer (Castro 1983, Pratt and Casey 1987). Births occur over a long season; females move inshore briefly to give birth (The Shark Trust 1998). Litters size usually is 6-14. Young initially grow 15 cm/year. Sexual maturity is not attained until a size of 2.79-3.37 m total length (Hoenig and Gruber 1987); males reach sexual maturity at about 290 cm total length, females at about 300 cm total length.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Viviparous, with a yolk-sac placenta, litter size 3-14 pups. 70-100 cm at birth.
  • Bigelow, H. B. and Schroeder,W.C.,1953; Compagno, L.J.V., 1984; Compagno, L.J.V., D.A. Ebert and M.J. Smale, 1989; Bass, A.J., P.C. Heemstra and L.J.V Compagno, 1986 ; Last, P.R. and J.D. Stevens, 1994.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus obscurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGGCAACCTGGATCACTTTTAGGAGATGATCAGATTTATAATGTAATCGTAACCGCCCACGCTTTTGTAATAATCTTTTTCATGGTTATACCAATTATAATTGGTGGTTTCGGAAATTGATTAGTTCCTTTAATAATTGGAGCGCCAGATATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTTCTTCTTCTCCTCGCCTCTGCTGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTTTATCCTCCATTAGCTAGCAATCTAGCACATGCTGGACCATCTGTTGATTTAGCTATTTTTTCTCTTCACTTAGCCGGTGTTTCATCAATTTTAGCTTCAATTAATTTTATCACAACCATTATTAATATAAAACCACCAGCTATTTCCCAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCCTCTCACTTCCAGTTCTTGCAGCAGGAATTACAATATTACTTACAGATCGTAACCTTAATACTACATTCTTTGACCCTGCAGGTGGAGGAGACCCAATCCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus obscurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1abd

Version
2.3

Year Assessed
2000

Assessor/s
Camhi, M., Musick, J.A. & Simpfendorfer, C.

Reviewer/s
Musick, J.A. & Fowler, S. (Shark Red List Authority)

Contributor/s

Justification
A large, wide-ranging, coastal and pelagic warm water species. Among the slowest-growing, latest-maturing of known sharks, bearing small litters after a long gestation, and one of the most vulnerable of vertebrates to depletion by man because of its very low intrinsic rate of increase. Difficult to manage or protect because it is taken with other more productive sharks in mixed species fisheries, and has a high mortality rate when taken as bycatch. Catch rates for Dusky Shark in the western Atlantic have declined markedly. The population in the northwestern Atlantic and Gulf of Mexico is now probably at 15-20% of its mid-1970s abundance. In other regions the impact of fishing has not been as great, but still requires close monitoring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd

Version
3.1

Year Assessed
2009

Assessor/s
Musick, J.A., Grubbs, R.D., Baum, J. & Cortés, E.

Reviewer/s
Stevens, J.D., Dudley, S.D. Pollard, D. & Soldo, A. (Shark Red List Authority)

Contributor/s

Justification
The Dusky Shark (Carcharhinus obscurus) is a large wide-ranging coastal and pelagic warm water species, which is among the slowest-growing, latest-maturing of known sharks, bearing small litters after a long gestation period. Its very low intrinsic rate of increase renders this species among the most vulnerable of vertebrates (including the great whales and sea turtles) to depletion by fisheries. Unfortunately the dusky shark is difficult to manage or protect because it is taken with other more productive sharks in mixed species fisheries, and has a high mortality rate when taken as bycatch. This species? fins are highly valued. Time series data are available from the Northwest and Western Central Atlantic, where catch rates have declined. Management requiring all individuals captured in the US longline fishery to be released was introduced in 2000, however, while this may have led to an increase in the numbers of juvenile sharks, adults still appear to be declining. A recent stock assessment of the fishery off southwestern Australia estimated that CPUE of this species declined by >75% from the early 1970s?2004. Additional management measures were then introduced to this fishery in 2006. Given the very high intrinsic vulnerability of this species? to depletion, significant estimated declines in several areas of its range and inferred declines in highly fished areas from which data are not available, C. obscurus is assessed as Vulnerable globally.

Northwest and Western Central Atlantic
The initial decline in C. obscurus in this area was caused by a targeted recreational fishery that developed in the late-1970s and by bycatch in the pelagic swordfish longline fishery. This was followed by rapid expansion on the US directed commercial shark fishery in the late 1980s. The species was protected in US Atlantic waters in 2000 as a result of declines in abundance. Although this management action may have led to an increase in the numbers of juvenile Dusky Sharks, adults still appear to be declining. A stock assessment which analysed catch data and multiple fisheries-independent and fisheries-dependent time series data sets led to estimated declines in dusky shark abundance of 62?92% between 1974 and 2003. Other analyses based on long term survey data from off North Carolina, observer data from the US Atlantic pelagic longline fishery and data from US pelagic longline research surveys and observer data from the Gulf of Mexico estimated declines of between 70 and 98.8% over periods of 13?40 years. Given the decline in abundance in this region, C. obscurus is assessed as Endangered in the Northwest and Western Central Atlantic.

Mediterranean Sea
The first record of the presence of this species in the Mediterranean was in 1928 off Spain, and since then, records from other areas (e.g., Sicily Straits) have been sporadic but possibly under-represented because of misidentification with similar ?grey sharks? requiem sharks. It is caught sporadically in a variety of fishing gears, principally off North Africa, but also in the Sicilian Channel, and marketed. Significant population declines have been estimated in other large shark species in the Mediterranean Sea as a result of intensive coastal and pelagic fishing pressure. However, there is currently insufficient information on occurrences of this species there to make an assessment beyond Data Deficient in this region.

Southwest Atlantic
This species is taken both incidentally and as a target species in longline and intensive artisanal fisheries in the South Atlantic. A number of countries operate longline fleets targeting tuna and swordfish in the Southwest Atlantic. Sharks are now known to be targeted due to increasing demand for shark products and the high value of their fins. Significant declines have been estimated in other areas of this species? range for which population trend data are available. Given the species? highly restricted life-history characteristics and continued fishing pressure in this area, C. obscurus is considered to qualify for at least Near Threatened in the Southwest Atlantic and may be found to meet the criteria for Vulnerable A2bd.

Australia
This species occurs throughout Australian waters. A demersal gillnet fishery off southwestern Australia targets neonates of this species on their nursery grounds. This fishery developed in the 1940s and rapidly increased in the late 1970s to produce annual catches of 500?600 t. A recent stock assessment found that the stock was less productive than previously thought, and that mortality of older dusky sharks in wetline fisheries outside the target fisheries was leading to a decline in recruitment. This assessment also estimated that the catch per unit effort (CPUE) of Dusky Sharks declined by more than 75% between the early 1970s and 2004 and that the decline was continuing. In 2006 additional management measures were introduced to the fishery, including a maximum size limit for dusky shark. These management measures should arrest further declines, but continued monitoring and assessment will be essential to monitor the stock, and the effectiveness of these measures. All this considered, the species is assessed as Near Threatened throughout Australian waters, close to meeting the criteria for Vulnerable A1bd. Continued monitoring and regular reassessment is recommended.

History
  • 2000
    Lower Risk/near threatened
  • 1996
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Widespread distribution throughout most warm oceans; unknown number of occurrences and individuals; populations are likely to have declined wherever there is fishing; vulnerable to and probably very threatened by overfishing, due to slow growth and low reproductive rate; no known protected occurrences; habitat degradation in coastal areas may affect nursery grounds for young.

Other Considerations: The IUCN Shark Specialist Group recently evaluated the status of C. obscurus using the listing criteria for the 1996 IUCN Red List of Threatened Species. On a global basis, the dusky shark was determined to be "Lower risk, near threatened." However, the U.S. population in the Northwestern Atlantic and Gulf of Mexico was evaluated to be "Vulnerable" based on the decline in abundance indices. The status in Australia was "Lower risk, near threatened." Source: http://www.nmfs.noaa.gov/prot_res/species/fish/Dusky_shark.html.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is estimated to have undergone population decline in several areas of its range, as summarized in the threats section, below.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: In the northwestern Atlantic, the species has declined by 80 percent in the last 20 years (Wilmot 1998). As of the early 2000s, the dusky shark population in the northwestern Atlantic and Gulf of Mexico was probably at 15-20% of its mid-1970s abundance (http://www.nmfs.noaa.gov/prot_res/species/fish/Dusky_shark.html). Declining catch rates for dusky sharks in the western Atlantic are a cause for concern. Not much in-depth information on the trend of other populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The species has a very slow growth rate, with late maturation, long gestation period, and small litters. Its very low intrinsic rate of increase makes it particularly vulnerable to depletion by man. The species is taken with other more productive sharks in mixed species fisheries, and has a high mortality rate when taken as bycatch.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Carcharhinus obscurus is taken as both bycatch and target in commercial shark fisheries using, set nets, longlines, hook and line and trawls (Cramer 1995, Compagno in prep.) in many areas of its range. The species has among the most sought after fins for shark fin soup because of their large size and high fin needle content (ceratotrichia) (TRAFFIC 1996, R. Hudson pers. comm.). Because of its high-value fin, dusky sharks caught incidentally in tuna and swordfish fisheries are now regularly landed rather than released. Carcharhinus obscurus was found to represent at least 1.2?1.7% of the fins auctioned in Hong Kong, the world?s largest shark fin trading center (Clarke et al. 2006a). It is estimated that between 144,000 and 767,000 Dusky Sharks are represented in the shark fin trade each year or, in biomass, 6,000 to 30,000 mt (Clarke et al. 2006b). The very low intrinsic rate of increase of the Dusky Shark renders this species among the most vulnerable of all vertebrates (including great whales and sea turtles) to man-induced mortality (Compagno et al. 2005, Musick 1999). Furthermore, Compagno et al. (2005) report that the species is difficult to manage or protect because it is taken in mixed species fisheries, and has a high mortality rate when taken as bycatch.

Further threats to C. obscurus are from beach meshing programs in Australia and South Africa and from recreational fishing. Beach meshing in Australia (Queensland and News South Wales) undoubtedly catches C. obscurus, however, species-specific data are not available. Between 1972 and 1990, the New South Wales programme caught a total of 765 whaler sharks (Reid and Krough 1992), of which Stevens (1984) reported the capture of larger juvenile and adult C. obscurus by recreational fishers off the east coast of Australia. Dusky sharks were one of the most important species in the trophy shark tournaments held in Florida, USA, until the stock collapsed (Heuter 1994).

Northwest and Western Central Atlantic
The initial decline of C. obscurus in the Northwest and Western Central Atlantic was caused by a targeted recreational fishery that developed in the late-1970s and by bycatch in the pelagic swordfish longline fishery (Musick et al. 1993). A rapid expansion of the directed commercial shark fishery in the US in the late 1980s was fuelled in large part by the demand for shark fins in the markets of Asia (Cook 1990). Although Dusky Shark meat is used domestically in the US, the very high value of the fins suggests that the decline in this dusky shark population over past decades has been, and continues to be, driven by international trade in shark fins. There is little reason to believe that the demand for dusky shark products will lessen, especially as other fishery resources become increasingly depleted. In the Gulf of Mexico during the late 1980s, the dusky shark was the fourth most abundant species in the tuna longline bycatch, where medium to large dusky sharks were often shot, finned and discarded (Russell 1993).

Declining catch rates for Dusky Sharks in this area have been a cause for concern. Off North America the proportion of C. obscurus in the catch decreased, while fishing for more abundant species continued (Musick et al. 1993). Carcharhinus obscurus was put on the protected list in 2000, requiring all individuals captured in the longline fishery to be released. Even though the mortality of small juveniles on the longline was as high as 50% (lower for larger juveniles and adults) (Romine 2004), the juveniles have shown an increase of about 30% from the lowest point in the time series to 2005 in the Virginia Institute of Marine Science (VIMS) survey, and continue to rise. This increase was not apparent in the stock assessment, which analysed catch data and multiple fisheries-independent and fisheries-dependent time series data sets in the western Atlantic (NMFS 2006). This assessment led to estimated declines of 62?92% between 1974 and 2003. These declines are of the same magnitude as those found in analyses of the VIMS survey data (Musick et al. 1993, Romine 2004, Ha 2006), but in these studies the low point in Dusky Shark abundance occurred in the early-1990s. The NMFS (2006) assessment, which did not include the 2004?2006 VIMS survey data (which shows a further increase in juveniles) may not have detected the recent increase of juveniles because it was heavily influenced by pelagic data sets collected in deep water where juveniles are absent. The other long-term shark targeted survey in this region, which has been conducted off Cape Lookout, North Carolina through the University of North Carolina annually between 1972 and 2005 (data available to 2003) has captured 1,036 Dusky Sharks. This survey series shows a large, statistically significant decline of 98.8% (95%CI: 97.5?99.6%) and found evidence of no increase in recent years (Myers et al. in prep.).

A new analysis of observer data from the U.S. Atlantic pelagic longline fishery from 1992?2005 (which combined catches of Dusky, Silky, and Night Sharks because of identification problems) suggests that this species complex has declined significantly, by 70% (95% CI: 54-81%) during this recent time period (Baum et al. in prep.). The observer data shows a steeper decline when Dusky Shark is analysed alone, but this analysis ignores species identification problems, and hence is not considered reliable (Baum et al. in prep.). For the Gulf of Mexico, an analysis of data from U.S. pelagic longline research surveys conducted in the mid-1950s and U.S. pelagic longline observer data from the late-1990s estimated that dusky sharks declined by 79% over this forty-year period (Baum and Myers 2004), which is less than the three generation period for this species. Thus, recent management actions in the US may have led to an increase in the numbers of juvenile Dusky Sharks, however adults still appear to be declining.

Southwest Atlantic
This species is taken both incidentally and as a target species in longline and artisanal fisheries throughout Brazilian waters and elsewhere in the South Atlantic. It is taken by longline off Santos where it is retained as ?other sharks? (Arfelli and Amorim 1994). The species has also been recorded from artisanal fisheries off Rio de Janeiro State (Sant'Anna and Siqueira 2000) and from southern Sao Paulo State (Motta et al. 1997, Bertozzi et al. 2000, Gadig et al. 2000). From July 1996 to February 1997 the species made up 1.12% of the catch (Motta et al. 1997) and 5.61% of the total catch from 1996 to 1999, which consisted mostly of juveniles, most frequently caught in June and August (Gadig et al. 2000). A number of countries operate longline fleets targeting tuna and swordfish in the high seas areas of the Southwest Atlantic region. In addition to the coastal nations of the Southwest Atlantic, nations including Taiwan, Korea, Japan, Spain, Bolivia, Cape Verde, United Kingdom, China and Barbados also operate vessels here. Tuna and swordfish longline fisheries now also target sharks due to increasing demand for shark products and the value of their fins (Bonfil et al. 2005, Mejuto et al. 2005).

Mediterranean Sea
The main threats in the Mediterranean Sea are commercial fisheries. This species is caught sporadically in longline, setline, gillnet and sometimes by tuna trap (?Tonnara? Tonnarella?) fisheries, principally off North African and rather less frequently by surface longlines, artisanal setlines and possibly trawlers in the Sicilian Channel. Carcharhinid sharks have been caught as target or bycatch in historical fisheries in this region, where fishing pressure is high, however there are few species-specific records from which to elucidate population trends. Carcharhinus obscurus is rarely observed on fishmarkets in the Mediterranean, but is easily mistaken for other ?grey? requiem shark carcasses, such as C. plumbeus. This species is utilised for human consumption in several areas of the Mediterranean, including Sicily, Malta and Libya, although the meat is considered of low commercial value.

Australia
The fishery for C. obscurus off southwestern Australia developed in the 1940s, but rapidly increased in the late 1970s to produce annual catches of 500?600 t. The fishery uses demersal gillnets (16.5 to 17.8 cm stretched mesh) to target neonates in the nursery area and the selectivity of the nets results in very few individuals over three years of age being captured. The flesh of the young C. obscurus is highly regarded and fetches a good price on local markets. Fins are also sold. Current estimates are that 18?28% of neonates are caught in their first year. An assessment using demographic models indicated that the fishery was sustainable at the then level of catch provided the fishing mortality of animals larger than two metres was less than 4% (Simpfendorfer 1999). However, a more recent assessment (McAuley et al. 2005) found that the stock was less productive than previously thought, and that mortality of older dusky sharks in wetline fisheries outside the target fisheries was leading to a decline in recruitment. This assessment also estimated that the catch per unit effort (CPUE) of Dusky Sharks declined by more than 75% between the early 1970s and 2004, and that the decline was continuing. In 2006 additional management measures were introduced to the fishery (see below), including a maximum size limit for Dusky Shark. These management measures should arrest further declines, but continued monitoring and assessment will be essential to monitor the stock, and the effectiveness of these measures.

South Africa
Off South Africa, there is a pelagic tuna longline fishery that may take some as bycatch but this is unconfirmed. There is a small commercial line fishery taking juvenile C. obscurus, and there is a recreational line fishery that targets juvenile C. obscurus but most are released (they were not released a decade ago) and there is the beach meshing operation that catches juveniles, adolescents and adults. Carcharhinus obscurus would have been a significant component in the beach meshing program off KwaZulu-Natal, South Africa, between 1978 and 1999, when the mean annual catch of was 256 individuals (range 129?571, Dudley et al. 2005). There was no trend in either catch or catch rate. A subsequent update by Dudley and Simpfendorfer (2006) showed no trend in either catch rate or size over the period 1978?2003. The large mesh size of the nets used in these programs means that many of the C. obscurus taken are sub-adults and adults, but juveniles are also caught. The occurrence of sub-adult and adult C. obscurus off KwaZulu-Natal is affected by an annual winter influx of sardines Sardinops sagax and shark catches are influenced by attempts to remove the nets in advance of the arrival of the sardine shoals (Dudley et al. 2005). Reports of C. obscurus in recreational fisheries are limited. Van der Elst (1979) reported that large numbers of juvenile C. obscurus were taken by recreational shore anglers in South Africa and Govender and Birnie (1997) have expressed concerns about the high rate of instantaneous fishing mortality in this fishery, although there is an increasing tendency to release the sharks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: The primary threat to C. obscurus is from commercial and recreational shark fisheries off the east coast of North America (Castro 1987), the southwest coast of Australia, and the eastern coast of South Africa. In each of these locations there are longline and/or gillnet fisheries that target sharks, including C. obscurus. In all cases these are multispecies fisheries making the management of a single species such as C. obscurus more difficult. Off North America, the proportion of C. obscurus in the catch is decreasing, while fishing for more abundant species continues, which could drive the C. obscurus population toward extirpation (http://www.nmfs.noaa.gov/prot_res/species/fish/Dusky_shark3.html). This shark is represented in the Yucatan commercial fishery and is one of the most important sharks by weight (Bonfil et al. 1990). Historically this species was not taken in large enough numbers to be of any commercial importance anywhere (Tee-van et al 1948), but this situation has significantly changed in the past 50 years.

In addition to harvest by targeted fisheries, dusky sharks are also taken as bycatch in directed tuna and swordfish longline fisheries (as well as being targeted catch by these vessels), in tuna and swordfish gill net fisheries (Cramer 1995). In the Gulf of Mexico during the late 1980s, the dusky shark was the fourth most abundant species in the tuna longline bycatch, where medium to large dusky sharks were often shot, finned, and discarded (Russell 1993). Because of its high-value fin, dusky sharks caught incidentally on tuna and swordfish longlines are now regularly landed rather than released. This shark is also caught by Japanese tuna longline vessels (Taniuchi 1990).

Dusky sharks are often marketed fresh in seafood markets throughout its range. Decline has been fueled in part by a demand for shark fins in the markets of Asia, where dusky fins are prized because of their large size and high quality (Wilmot 1998).

Although not classed as a gamefish, dusky sharks are sought by anglers for their fighting qualities(Castro 1983). Dusky sharks have been one of the most important species in the trophy shark tournaments held in Florida, USA (Heuter 1994).

Coastal and estuarine areas important for young, therefore, habitat degradation from mechanical and water quality impacts may pose a threat (Pratt and Casey 1987).

The relationship between stock and recruitment is likely to be direct, owing to the reproductive strategy of low fecundity combined with few, well-formed offspring (Hoenig and Gruber 1987). The number of young that can be produced is strictly limited to and dependent on the number of adults. Dusky sharks, which can live to a maximum age of 40-50 years, are especially vulnerable to overfishing because they are slow growing (Branstetter 1990), do not sexually mature until age 20, their reproductive cycle is exceptionally long (up to three years), and they produce few offspring (Hoenig and Gruber 1987, Branstetter 1990, Wilmot 1998). Currently dusky sharks are being killed faster than they can reproduce (Wilmot 1998).

An increasing number of sharks (including the dusky shark) are becoming encircled by plastic packing straps, which cut into the animal's flesh and cause inflamed wounds and eventually suffocation (Lombardi and Morton 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Precautionary adaptive collaborative management of target and bycatch fisheries is needed for this biologically vulnerable shark. It is also essential to improve data collection and develop stock assessments for this species. Family Carcharhinidae is listed as highly migratory under the 1995 UN Agreement on the Conservation and Management of Straddling Fish Stocks and Highly Migratory Fish Stocks (UNFSA). The Agreement specifically requires coastal and fishing States to cooperate and adopt measures to ensure the conservation of listed species. To date, there has been little progress (see United Nations Convention on the Law of the Sea for further details). Also of relevance is the FAO International Plan of Action for the Conservation and Management of Sharks (IPOA-Sharks) which recommends that Regional Fisheries Organisations (RFO?s) carry out regular shark population assessments and that member States cooperate on joint and regional shark management plans. This is of particular importance for species such as dusky shark whose stocks are exploited by many States on the high seas. Steps are being taken by some RFOs, such as ICCAT, to collect species-specific data on pelagic sharks. To date two RFOs, ICCAT and IATTC, have adopted finning bans, as have several range states (e.g., Canada, USA, EU, Australia, Brazil etc.). More are likely to follow suit.

Canada and the USA have shark management plans (NMFS 1993, Joyce 1999). In US Atlantic waters dusky sharks are a prohibited species (outside of the shark research fishery) on the Fishery Management Plan for Atlantic tunas, swordfish, and sharks. Prohibited species must be released immediately with minimum injury and without removing them from the water. The population appears to be responding to this measures, with substantial recruitment over the last six years (Ha 2006, Musick unpublished, Romine 2004), but it remains to be seen how many of these recruits will survive to maturity given the high bycatch mortality.

Management of the Australian fishery is through input controls implemented as time-gear units. In 2006, the Western Australian Government introduced a number of changes in all commercial fisheries to reduce mortality, particularly of dusky and sandbar sharks, including: a maximum size limit for Dusky Shark; additional controls on the use of longline; and the conversion of monthly gear units to daily gear units (McLoughlin 2008, McAuley et al. 2005). The main management objective is to achieve target biomass levels of 40% of the initial biomass by 2040 for Dusky Shark (McLoughlin 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: On October 21, 1998, the Highly Migratory Species (HMS) Management Division of NMFS announced the availability of the draft Fishery Management Plan (FMP) for Atlantic highly migratory species, including dusky sharks. The draft FMP addressess rebuilding of overfished stocks. As part of the rebuilding efforts, dusky sharks will be listed as a prohibited species, meaning that the shark can not be taken in commercial or recreational fisheries (NMFS website, http://www.nmfs.noaa.gov/prot_res/species/fish/Dusky_shark.html).

Biological Research Needs: There is a need to better understand population dynamics and reproduction (Tee-Van et al. 1948).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Comments: No known protected occurrences. Management is problematic because of the difficulty in obtaining accurate landing statistics due to the diffuse nature of fish handling systems; also due to the low priority based upon low values of landings (Hoenig and Gruber 1987). In 1989, the National Marine Fisheries Service judged large coastal sharks (including the dusky shark) to have been overfished by 2,348 metric tons and in 1990 by 1,431 metric tons. As a result, the National Marine Fisheries Service set annual poundage quotas, called total allowable catches for each of the heavily fished groups. In 1993 the total allowable catch for large coastal sharks was set at 2,436 metric tons plus a 464 metric tons recreational quota. The total allowable catch for large coastal sharks was set to be adjusted annually upward at 80% of the annual surplus production. This strategy was predicted to allow for a population increase leading to a return of the natural Maximum Sustainable Yield by the year 2000 (Burgess 1998). Sport anglers were restricted to two sharks per boat per trip for combined large coastal and pelagic sharks. Sale of recreationally caught sharks was prohibited (Burgess 1998). Finning of sharks by commercial fisheries and recreational anglers was prohibited. In addition a system of data collection and reporting was partially implemented (Burgess 1998). Still this plan has underestimated the recovery of the stocks (Burgess 1998). The total annual take of large coastal sharks was reduced to a total of 2,570 metric tons in 1994 and additional restrictions may be forthcoming (Burgess 1998).

Needs: International trade in dusky sharks should be monitored and better controlled (Wilmot 1998). A more comprehensive and long-term effort is required to effectively address the problem of plastics pollution in marine environments, which is threatening many marine species (Lombardi and Morton 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Known to infrequently attack humans. The hide is often used for leather. See GTHREATCOM in EGR.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dusky shark

The dusky shark (Carcharhinus obscurus) is a species of requiem shark, family Carcharhinidae, occurring in tropical and warm-temperate continental seas worldwide. A generalist apex predator, the dusky shark can be found from the coast to the outer continental shelf and adjacent pelagic waters, and has been recorded from a depth of 400 m (1,300 ft). Populations migrate seasonally towards the poles in the summer and towards the equator in the winter, traveling hundreds to thousands of kilometers. One of the largest members of its genus, the dusky shark reaches 4.2 m (14 ft) in length and 347 kg (765 lb) in weight. It has a slender, streamlined body and can be identified by its short round snout, long sickle-shaped pectoral fins, ridge between the first and second dorsal fins, and faintly marked fins.

Adult dusky sharks have a broad and varied diet, consisting mostly of bony fishes, sharks and rays, and cephalopods, but also occasionally crustaceans, sea stars, bryozoans, sea turtles, marine mammals, carrion, and garbage. This species is viviparous with a three-year reproductive cycle; females bear litters of 3–14 young after a gestation period of 22–24 months, after which there is a year of rest before they become pregnant again. Females are capable of storing sperm for long periods, as their encounters with suitable mates may be few and far between due to their nomadic lifestyle and low overall abundance. Dusky sharks are one of the slowest-growing and latest-maturing sharks, not reaching adulthood until around 20 years of age.

Because of its slow reproductive rate, the dusky shark is very vulnerable to human-caused population depletion. This species is highly valued by commercial fisheries for its fins, used in shark fin soup, and for its meat, skin, and liver oil. It is also esteemed by recreational fishers. The International Union for Conservation of Nature (IUCN) has assessed this species as Near Threatened worldwide and Vulnerable off the eastern United States, where populations have dropped to 15–20% of 1970s levels. The dusky shark is regarded as potentially dangerous to humans due to its large size, but there are few attacks attributable to it.

Contents

Taxonomy [edit]

French naturalist Charles Alexandre Lesueur published the first scientific description of the dusky shark in an 1818 issue of Journal of the Academy of Natural Sciences of Philadelphia. He placed it in the genus Squalus and gave it the specific epithet obscurus (Latin for "dark" or "dim"), referring to its coloration.[3][4] Subsequent authors have recognized this species as belonging to the genus Carcharhinus. Lesueur did not designate a type specimen, though he was presumably working from a shark caught in North American waters.[5]

Many early sources gave the scientific name of the dusky shark as Carcharias (later Carcharhinus) lamiella, which originated from an 1882 account by David Starr Jordan and Charles Henry Gilbert. Although Jordan and Gilbert referred to a set of jaws that came from a dusky shark, the type specimen they designated was later discovered to be a copper shark (C. brachyurus). Therefore, C. lamiella is not considered a synonym of C. obscurus but rather of C. brachyurus.[4][6] Other common names for this species include bay shark, black whaler, brown common gray shark, brown dusky shark, brown shark, common whaler, dusky ground shark, dusky whaler, river whaler, shovelnose, and slender whaler shark.[7]

Phylogeny and evolution [edit]




Carcharhinus altimus



Carcharhinus plumbeus





Carcharhinus falciformis




Carcharhinus perezi




Carcharhinus galapagensis



Carcharhinus obscurus



Carcharhinus longimanus



Prionace glauca






Phylogenetic relationships of the dusky shark, based on allozyme sequences.[8]

Teeth belonging to the dusky shark are fairly well represented in the fossil record, though assigning Carcharhinus teeth to species can be problematic.[9] Dusky shark teeth dating to the Miocene (23-5.3 Ma) have been recovered from the Kendeace and Grand Bay formations in Carriacou, the Grenadines,[10] the Moghra Formation in Egypt,[11] Polk County, Florida,[12] and possibly Cerro La Cruz in northern Venezuela.[13] Teeth dating to the Late Miocene or Early Pliocene (11.6-3.6 Ma) are abundant in the Yorktown Formation and the Pungo River, North Carolina, and from the Chesapeake Bay region; these teeth differ slightly from the modern dusky shark, and have often been misidentified as belonging to the oceanic whitetip shark (C. longimanus).[9] Dusky shark teeth have also been recovered from the vicinity of two baleen whales in North Carolina, one preserved in Goose Creek Limestone dating to the Late Pliocene (c. 3.5 Ma), and the other in mud dating to the Pleistocene-Holocene (c. 12,000 years ago).[14]

In 1982, Jack Garrick published a phylogenetic analysis of Carcharhinus based on morphology, in which he placed the dusky shark and the Galapagos shark (C. galapagensis) at the center of the "obscurus group". The group consisted of large, triangular-toothed sharks with a ridge between the dorsal fins, and also included the bignose shark (C. altimus), the Caribbean reef shark (C. perezi), the sandbar shark (C. plumbeus), and the oceanic whitetip shark.[15] This interpretation was largely upheld by Leonard Compagno in his 1988 phenetic study,[16] and by Gavin Naylor in his 1992 allozyme sequence study. Naylor was able to further resolve the interrelationships of the "ridge-backed" branch of Carcharhinus, finding that the dusky shark, Galapagos shark, oceanic whitetip shark, and blue shark (Prionace glauca) comprise its most derived clade.[8]

Distribution and habitat [edit]

A grey shark swimming in shallow, sun-dappled waters, with a large school of smaller fish in the background
A female dusky shark on display at Sea World, Queensland; this species is found throughout Australian waters.

The range of the dusky shark extends worldwide, albeit discontinuously, in tropical and warm-temperate waters. In the western Atlantic Ocean, it is found from Massachusetts and the Georges Bank to southern Brazil, including the Bahamas and Cuba. In the eastern Atlantic Ocean, it has been reported from the western and central Mediterranean Sea, the Canary Islands, Cape Verde, Senegal, Sierra Leone, and possibly elsewhere including Portugal, Spain, Morocco, and Madeira. In the Indian Ocean, it is found off South Africa, Mozambique, and Madagascar, with sporadic records in the Arabian Sea, the Bay of Bengal, and perhaps the Red Sea. In the Pacific Ocean, it occurs off Japan, mainland China and Taiwan, Vietnam, Australia, and New Caledonia in the west, and from southern California to the Gulf of California, around Revillagigedo, and possibly off northern Chile in the east. Records of dusky sharks from the northeastern and eastern central Atlantic, and around tropical islands, may in fact be of Galapagos sharks.[1][2] Mitochondrial DNA and microsatellite evidence suggest that Indonesian and Australian sharks represent distinct populations.[17]

Residing off continental coastlines from the surf zone to the outer continental shelf and adjacent oceanic waters, the dusky shark occupies an intermediate habitat that overlaps with its more specialized relatives, such as the inshore sandbar shark, the pelagic silky shark (C. falciformis) and oceanic whitetip shark, the deepwater bignose shark, and the islandic Galapagos shark and silvertip shark (C. albimarginatus).[5] One tracking study in the northern Gulf of Mexico found that it spends most of its time at depths of 10–80 m (33–260 ft), while making occasional forays below 200 m (660 ft); this species has been known to dive as deep as 400 m (1,300 ft). It prefers water temperatures of 19–28 °C (66–82 °F), and avoids areas of low salinity such as estuaries.[4][18]

The dusky shark is nomadic and strongly migratory, undertaking recorded movements of up to 3,800 km (2,400 mi);adults generally move longer distances than juveniles. Sharks along both coasts of North America shift northward with warmer summer temperatures, and retreat back towards the equator in winter.[1] Off South Africa, young males and females over 0.9 m (3.0 ft) long disperse southward and northward respectively (with some overlap) from the nursery area off KwaZulu-Natal; they join the adults several years later by a yet-unidentified route. In addition, juveniles spend spring and summer in the surf zone and fall and winter in offshore waters, and as they approach 2.2 m (7.2 ft) in length begin to conduct a north-south migration between KwaZulu-Natal in the winter and the Western Cape in summer. Still-larger sharks, over 2.8 m (9.2 ft) long, migrate as far as southern Mozambique.[1][5][19] Off Western Australia, adult and juvenile dusky sharks migrate towards the coast in summer and fall, though not to the inshore nurseries occupied by newborns.[1]

Description [edit]

The dusky shark can be identified by its sickle-shaped first dorsal and pectoral fins, with the former positioned over the rear tips of the latter

One of the largest members of its genus, the dusky shark commonly reaches a length of 3.2 m (10 ft) and a weight of 160–180 kg (350–400 lb); the maximum recorded length and weight are 4.2 m (14 ft) and 347 kg (770 lb) respectively.[7][20] Females grow larger than males.[21] This shark has a slender, streamlined body with a broadly rounded snout no longer than the width of the mouth. The nostrils are preceded by barely developed flaps of skin. The medium-sized, circular eyes are equipped with nictitating membranes (protective third eyelids). The mouth has very short, subtle furrows at the corners and contains 13-15 (typically 14) tooth rows on either side of both jaws. The upper teeth are distinctively broad, triangular, and slightly oblique with strong, coarse serrations, while the lower teeth are narrower and upright, with finer serrations. The five pairs of gill slits are fairly long.[20]

The large pectoral fins measure around one-fifth as long as the body, and have a falcate (sickle-like) shape tapering to a point. The first dorsal fin is of moderate size and somewhat falcate, with a pointed apex and a strongly concave rear margin; its origin lies over the pectoral fin free rear tips. The second dorsal fin is much smaller and is positioned about opposite the anal fin. A low dorsal ridge is present between the dorsal fins. The caudal fin is large and high, with a well-developed lower lobe and a ventral notch near the tip of the upper lobe.[22] The dermal denticles are diamond-shaped and closely set, each bearing five horizontal ridges leading to teeth on the posterior margin.[20] This species is bronzy to bluish gray above and white below, which extends onto the flanks as a faint lighter stripe. The fins, particularly the underside of the pectoral fins and the lower caudal fin lobe) darken towards the tips; this is more obvious in juveniles.[23]

Biology and ecology [edit]

As an apex predator positioned at the highest level of the trophic web, the dusky shark is generally less abundant than other sharks that share its range.[5] However, high concentrations of individuals, especially juveniles, can be found at particular locations.[4] Adults are often found following ships far from land, such as in the Agulhas Current.[19] A tracking study off the mouth of the Cape Fear River in North Carolina reported an average swimming speed of 0.8 km/h (0.50 mph).[24] The dusky shark is one of the hosts of the sharksucker (Echeneis naucrates).[25] Known parasites of this species include the tapeworms Anthobothrium laciniatum,[26] Dasyrhynchus pacificus,[27] Platybothrium kirstenae,[28] Rhynchobothrium ingens,[29] Tentacularia coryphaenae,[30] and Triloculatum triloculatum,[31] the monogeneans Dermophthirius carcharhini[32] and Loimos salpinggoides,[33] the leech Stibarobdella macrothela,[34] the copepods Alebion sp., Pandarus cranchii,[35] P. sinuatus,[20] and P. smithii, the praniza larvae of gnathiid isopods,[35] and the sea lamprey (Petromyzon marinus).[36]

Full-grown dusky sharks have no significant natural predators.[20] Major predators of young sharks include the ragged tooth shark (Carcharias taurus), the great white shark (Carcharodon carcharias), the bull shark (C. leucas), and the tiger shark (Galeocerdo cuvier). Off KwaZulu-Natal, the use of shark nets to protect beaches has reduced the populations of these large predators, leading to a dramatic increase in the number of juvenile dusky sharks (a phenomenon called "predator release"). In turn, the juvenile sharks have decimated populations of small bony fishes, with negative consequences for the biodiversity of the local ecosystem.[5][37]

Feeding [edit]

A silvery, spindle-shaped ray-finned fish with a forked tail
The bluefish is a major prey species of dusky sharks in the northwestern Atlantic.

The dusky shark is a generalist that takes a wide variety of prey from all levels of the water column, though it favors hunting near the bottom.[23][38] A large individual can consume over a tenth of its body weight at a single sitting.[39] The bite force exerted by a 2 m (6.6 ft) long dusky shark has been measured at 60 kg (130 lb) over the 2 mm2 (0.0031 sq in) area at the tip of a tooth. This is the highest figure thus far measured from any shark, though it also reflects the concentration of force at the tooth tip.[40] Dense aggregations of young sharks, forming in response to feeding opportunities, have been documented in the Indian Ocean.[1]

The known diet of the dusky shark encompasses pelagic fishes, including herring and anchovies, tuna and mackerel, billfish, jacks, needlefish and flyingfish, threadfins, hairtails, lancetfish, and lanternfish; demersal fishes, including mullets, porgies, grunts, and flatheads, eels, lizardfish, cusk eels, gurnards, and flatfish; reef fishes, including barracudas, goatfish, spadefish, groupers, scorpionfish, and porcupinefish; cartilaginous fishes, including dogfish, sawsharks, angel sharks, catsharks, thresher sharks, smoothhounds, smaller requiem sharks, sawfish, guitarfish, skates, stingrays, and butterfly rays; and invertebrates, including cephalopods, decapod crustaceans, barnacles, and sea stars. Very rarely, the largest dusky sharks may also consume sea turtles, marine mammals (mainly as carrion), and human refuse.[4][5][38][41]

In the northwestern Atlantic, around 60% of the dusky shark's diet consists of bony fishes, from over ten families with bluefish (Pomatomus saltatrix) and summer flounder (Paralichthys dentatus) being especially important. Cartilaginous fishes, mainly skates and their egg cases, are the second-most important dietary component, while the lady crab (Ovalipes ocellatus) is also a relatively significant food source.[38] In South African and Australian waters, bony fishes are again the most important prey type. Newborn and juvenile sharks subsist mainly on small pelagic prey such as sardines and squid; older sharks over 2 m (6.6 ft) long broaden their diets to include larger bony and cartilaginous fishes.[42][43] The run of the southern African pilchard (Sardinops sagax), occurring off the eastern coast of South Africa every winter, is attended by medium and large-sized dusky sharks. Pregnant and post-partum females do not join, possibly because the energy cost of gestation leaves them unable to pursue such swift prey.[39] One South African study reported that 0.2% of the sharks examined had preyed upon bottlenose dolphins (Tursiops truncatus).[44]

Life history [edit]

Like other requiem sharks, the dusky shark is viviparous: the developing embryos are initially nourished by a yolk sac, which is converted into a placental connection to the mother once the yolk supply is exhausted. Mating occurs during spring in the northwestern Atlantic, while there appears to be no reproductive seasonality in other regions such as off South Africa.[4][5] Females are capable of storing masses of sperm, possibly from multiple males, for months to years within their nidamental glands (an organ that secretes egg cases). This would be advantageous given the sharks' itinerant natures and low natural abundance, which would make encounters with suitable mates infrequent and unpredictable.[45]

With a gestation period estimated at up to 22–24 months and a one-year resting period between pregnancies, female dusky sharks bear at most one litter of young every three years.[1] The litter size ranges from 3 to 16, with 6 to 12 being typical, and does not correlate with female size.[4][39] Sharks in the western Atlantic tend to produce slightly smaller litters than those from the southeastern Atlantic (averaging 8 versus 10 pups per litter).[20] Depending on region, birthing may occur throughout the year or over a span of several months: newborn sharks have been reported from late winter to summer in the northwestern Atlantic, in summer and fall off Western Australia, and throughout the year with a peak in fall off southern Africa.[5][23] Females move into shallow inshore habitats such as lagoons to give birth, as such areas offer their pups rich food supplies and shelter from predation (including from their own species), and leave immediately afterward.[4][43] These nursery areas are known along the coasts of KwaZulu-Natal, southwestern Australia, western Baja California, and the eastern United States from New Jersey to North Carolina.[1][4]

Life history parameters of the dusky shark
RegionMale length and age at maturityFemale length and age at maturity
Northwestern Atlantic2.80 m (9.2 ft), 19 years[21]2.84 m (9.3 ft), 21 years[21]
Eastern South Africa2.80 m (9.2 ft), 19–21 years[4][46][47]2.60–3.00 m (8.5–9.8 ft), 17–24 years[4][46]
Indonesia2.80–3.00 m (9.2–9.8 ft), age unknown[48]2.80 m (9.2 ft), age unknown[48]
Western Australia2.65–2.80 m (8.7–9.2 ft), 18–23 years[23][49]2.95–3.10 m (9.7–10.2 ft), 27–32 years[23][50]

Newborn dusky sharks measure 0.7–1.0 m (2.3–3.3 ft) long;[1] pup size increases with female size, and decreases with litter size. There is evidence that females can determine the size at which their pups are born, so as to improve their chances of survival across better or worse environmental conditions. Females also provision their young with energy reserves, stored in a liver that comprises one-fifth of the pup's weight, which sustains the newborn until it learns to hunt for itself.[39] The dusky shark is one of the slowest-growing shark species, reaching sexual maturity only at a substantial size and age (see table).[51] Various studies have found growth rates to be largely similar across geographical regions and between sexes.[46][48][49] The annual growth rate is 8–11 cm (3.1–4.3 in) over the first five years of life.[52] The maximum lifespan is believed to be 40–50 years or more.[51]

Human interactions [edit]

Dusky shark tooth on a Gilbertese weapon.

The dusky shark is considered to be potentially dangerous to humans because of its large size, though little is known of how it behaves towards people underwater.[5] As of 2009, the International Shark Attack File lists it as responsible for six attacks on people and boats, three of them unprovoked and one fatal.[53] However, attacks attributed to this species off Bermuda and other islands were probably in reality caused by Galapagos sharks.[5] Shark nets used to protect beaches in South Africa and Australia entangle adult and larger juvenile dusky sharks in some numbers. From 1978 to 1999, an average of 256 individuals were caught annually in nets off KwaZulu-Natal; species-specific data is not available for nets off Australia.[51] Young dusky sharks adapt well to display in public aquariums.[5]

A fishery worker standing on a ship, holding a small shark in his gloved hands
Dusky sharks are highly valued by commercial fisheries.

The dusky shark is one of the most sought-after species for shark fin trade, as its fins are large and contain a high number of internal rays (ceratotrichia).[51] In addition, the meat is sold fresh, frozen, dried and salted, or smoked, the skin is made into leather, and the liver oil is processed for vitamins.[7] Dusky sharks are taken by targeted commercial fisheries operating off eastern North America, southwestern Australia, and eastern South Africa using multi-species longlines and gillnets. The southwestern Australian fishery began in the 1940s and expanded in the 1970s to yield 500–600 tons per year. The fishery utilizes selective demersal gillnets that take almost exclusively young sharks under three years old, with 18–28% of all newborns captured in their first year. Demographic models suggest that the fishery is sustainable, provided that the mortality rate of sharks over 2 m (6.6 ft) long is under 4%.[51]

In addition to commercial shark fisheries, dusky sharks are also caught as bycatch on longlines meant for tuna and swordfish (and usually kept for its valuable fins), and by recreational fishers. Large numbers of dusky sharks, mostly juveniles, are caught by sport fishers off South Africa and eastern Australia. This shark was once one of the most important species in the Florida trophy shark tournaments, before the population collapsed.[51]

Conservation [edit]

The International Union for Conservation of Nature (IUCN) has assessed this species as Near Threatened worldwide and Vulnerable in the northwestern Atlantic and the Gulf of Mexico. The American Fisheries Society has also assessed North American dusky shark populations as Vulnerable.[20] Its very low reproductive rate renders the dusky shark extremely susceptible to overfishing. Stocks off the eastern United States are severely overfished; a 2006 stock assessment survey by the U.S. National Marine Fisheries Service (NMFS) showed that its population had dropped to 15–20% of 1970s levels. In 1997, the dusky shark was identified as a "Species of Concern" by the NMFS, meaning that it warranted conservation concern but there was insufficient information for listing on the U.S. Endangered Species Act (ESA). Commercial and recreational retention of dusky sharks was prohibited in 1998, but this has been of limited effectiveness due to high bycatch mortality on multi-species gear. In addition, some 2,000 dusky sharks were caught by recreational fishers in 2003 despite the ban. In 2005, North Carolina implemented a time/area closure to reduce the impact of recreational fishing.[54] To aid conservation efforts, molecular techniques using polymerase chain reaction (PCR) have been developed that can identify whether marketed shark parts (e.g. fins) are from prohibited species like the dusky shark, versus similar allowed species such as the sandbar shark.[55]

References [edit]

  1. ^ a b c d e f g h i Musick, J.A.; Grubbs, R.D.; Baum, J. and Cortés, E. (2007). "Carcharhinus obscurus". IUCN Red List of Threatened Species. Version 2010.1. International Union for Conservation of Nature. Retrieved April 29, 2010. 
  2. ^ a b Compagno, L.J.V., M. Dando and S. Fowler (2005). Sharks of the World. Princeton University Press. pp. 302–303. ISBN 978-0-691-12072-0. 
  3. ^ Lesueur, C.A. (May 1818). "Description of several new species of North American fishes (part 1)". Journal of the Academy of Natural Sciences of Philadelphia 1 (2): 222–235. 
  4. ^ a b c d e f g h i j k Ebert, D.A. (2003). Sharks, Rays, and Chimaeras of California. University of California Press. pp. 160–162. ISBN 0-520-22265-2. 
  5. ^ a b c d e f g h i j k Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Food and Agricultural Organization. pp. 489–491. ISBN 92-5-101384-5. 
  6. ^ Jordan, D.S. and Gilbert, C.H. (July 3, 1882). "Description of a new shark (Carcharias lamiella) from San Diego, California". Proceedings of the United States National Museum 5 (269): 110–111. doi:10.5479/si.00963801.5-269.110. 
  7. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2009). "Carcharhinus obscurus" in FishBase. May 2009 version.
  8. ^ a b Naylor, G.J.P. (1992). "The phylogenetic relationships among requiem and hammerhead sharks: inferring phylogeny when thousands of equally most parsimonious trees result". Cladistics 8 (4): 295–318. doi:10.1111/j.1096-0031.1992.tb00073.x. 
  9. ^ a b Heim, B. and Bourdon, J. (April 20, 2009). Species from the Fossil Record: Carcharhinus obscurus. The Life and Times of Long Dead Sharks. Retrieved on April 29, 2010.
  10. ^ Portell, R.W.; Hubbell, G.; Donovan, S.K.; Green, J.K.; Harper, D.A.T. and Pickerill, R. (2008). "Miocene sharks in the Kendeace and Grand Bay formations of Carriacou, The Grenadines, Lesser Antilles". Caribbean Journal of Science 44 (3): 279–286. 
  11. ^ Cook, T.D.; Murray, A.M.; Simons, E.L.; Attia, Y.S. and Chatrath, P. (February 8, 2010). "A Miocene selachian fauna from Moghra, Egypt". Historical Biology: an International Journal of Paleobiology: 1029–2381. 
  12. ^ Brown, R.C. (2008). Florida's Fossils: Guide to Location, Identification, and Enjoyment (third ed.). Pineapple Press. p. 100. ISBN 1-56164-409-9. 
  13. ^ Sanchez-Villagra, M.R.; Burnham, R.J.; Campbell, D.C.; Feldmann, R.M.; Gaffney, E.S.; Kay, R.F.; Lozsan, R.; Purdy R. and Thewissen, J.G.M. (September 2000). "A New Near-Shore Marine Fauna and Flora from the Early Neogene of Northwestern Venezuela". Journal of Paleontology 74 (5): 957–968. doi:10.1666/0022-3360(2000)074<0957:ANNSMF>2.0.CO;2. 
  14. ^ Cicimurri, D.J. and Knight, J.L. (2009). "Two Shark-bitten Whale Skeletons from Coastal Plain Deposits of South Carolina". Southeastern Naturalist 8 (1): 71–82. doi:10.1656/058.008.0107. 
  15. ^ Garrick, J.A.f. (1982). Sharks of the genus Carcharhinus. NOAA Technical Report, NMFS Circ. 445: 1–194.
  16. ^ Compagno, L.J.V. (1988). Sharks of the Order Carcharhiniformes. Princeton University Press. pp. 319–320. ISBN 0-691-08453-X. 
  17. ^ Ovenden, J.R.; Kashiwagi, T.; Broderick, D.; Giles, J. and Salini, J. (2009). "The extent of population genetic subdivision differs among four co-distributed shark species in the Indo-Australian archipelago". BMC Evolutionary Biology 9: 40. doi:10.1186/1471-2148-9-40. PMC 2660307. PMID 19216767. 
  18. ^ Hoffmayer, E.R., Franks, J.S., Driggers, W.B. (III) and Grace, M.A. (March 26, 2009). "Movements and Habitat Preferences of Dusky (Carcharhinus obscurus) and Silky (Carcharhinus falciformis) Sharks in the Northern Gulf of Mexico: Preliminary Results." 2009 MTI Bird and Fish Tracking Conference Proceedings.
  19. ^ a b Van der Elst, R. and Borchert, P. (1993). A Guide to the Common Sea Fishes of Southern Africa (third ed.). Struik. p. 39. ISBN 1-86825-394-5. 
  20. ^ a b c d e f g Knickle, C. Biological Profiles: Dusky Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on May 18, 2009.
  21. ^ a b c Natanson, L.J., Casey, J.G. and Kohler, N.E. (1995). "Age and growth estimates for the dusky shark, Carcharhinus obscurus, in the western North Atlantic Ocean". Fishery Bulletin 93 (1): 116–126. 
  22. ^ McEachran, J.D. and Fechhelm, J.D. (1998). Fishes of the Gulf of Mexico: Myxiniformes to Gasterosteiformes. University of Texas Press. p. 82. ISBN 0-292-75206-7. 
  23. ^ a b c d e Last, P.R. and Stevens, J.D. (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. pp. 269–270. ISBN 0-674-03411-2. 
  24. ^ Huish, M.T. and Benedict, C. (1977). "Sonic tracking of dusky sharks in Cape Fear River, North Carolina". Journal of the Elisha Mitchell Scientific Society 93 (1): 21–26. 
  25. ^ Schwartz, F.J. (Summer 2004). "Five species of sharksuckers (family Echeneidae) in North Carolina". Journal of the North Carolina Academy of Science 120 (2): 44–49. 
  26. ^ Ruhnke, T.R. and Caira, J.N. (2009). "Two new species of Anthobothrium van Beneden, 1850 (Tetraphyllidea: Phyllobothriidae) from carcharhinid sharks, with a redescription of Anthobothrium laciniatum Linton, 1890". Systematic Parasitology 72 (3): 217–227. doi:10.1007/s11230-008-9168-0. PMID 19189232. 
  27. ^ Beveridge, I. and Campbell, R.A. (February 1993). "A revision of Dasyrhynchus Pintner (Cestoda, Trypanorhyncha), parasitic in elasmobranch and teleost fishes". Systematic Parasitology 24 (2): 129–157. doi:10.1007/BF00009597. 
  28. ^ Healy, C.J. (October 2003). "A revision of Platybothrium Linton, 1890 (Tetraphyllidea : Onchobothriidae), with a phylogenetic analysis and comments on host-parasite associations". Systematic Parasitology 56 (2): 85–139. doi:10.1023/A:1026135528505. PMID 14574090. 
  29. ^ Linton, E. (1921). "Rhynchobothrium ingens spec. nov., a parasite of the dusky shark (Carcharhinus obscurus)". Journal of Parasitology 8 (1): 22–32. doi:10.2307/3270938. JSTOR 3270938. 
  30. ^ Knoff, M.; De Sao Clemente, S.C.; Pinto, R.M.; Lanfredi, R.M. and Gomes, D.C. (April–June 2004). "New records and expanded descriptions of Tentacularia coryphaenae and Hepatoxylon trichiuri homeacanth trypanorhynchs (Eucestoda) from carcharhinid sharks from the State of Santa Catarina off-shore, Brazil". Revista Brasileira de Parasitologia Veterinaria 13 (2): 73–80. 
  31. ^ Caira, J.N. and Jensen, K. (2009). "Erection of a new onchobothriid genus (Cestoda: Tetraphyllidea) and the description of five new species from whaler sharks (Carcharhinidae)". Journal of Parasitology 95 (4): 924–940. doi:10.1645/GE-1963.1. PMID 19271790. 
  32. ^ Bullard, S.A.; Dippenaar, S.M.; Hoffmayer, E.R. and Benz, G.W. (January 2004). "New locality records for Dermophthirius carcharhini (Monogenea : Microbothriidae) and Dermophthirius maccallumi and a list of hosts and localities for species of Dermophthirius". Comparative Parasitology 71 (1): 78–80. doi:10.1654/4093. 
  33. ^ MacCullum, G.A. (1917). "Some new forms of parasitic worms". Zoopathologica; scientific contributions of the New York Zoological Society 1 (2): 1–75. 
  34. ^ Yamauchi, T.; Ota, Y. and Nagasawa, K. (August 20, 2008). "Stibarobdella macrothela (Annelida, Hirudinida, Piscicolidae) from Elasmobranchs in Japanese Waters, with New Host Records". Biogeography 10: 53–57. 
  35. ^ a b Newbound, D.R. and Knott, B. (November 1999). "Parasitic copepods from pelagic sharks in Western Australia". Bulletin of Marine Science 65 (3): 715–724. 
  36. ^ Jensen, C. and Schwartz, F.J. (December 1994). "Atlantic Ocean occurrences of the sea lamprey, Petromyzon marinus (Petromyzontiformes: Petromyzontidae), parasitizing sandbar, Carcharhinus plumbeus, and dusky, C. obscurus (Carcharhiniformes: Carcharhinidae), sharks off North and South Carolina". Brimleyana 21: 69–76. 
  37. ^ Martin, R.A. A Place For Sharks. ReefQuest Centre for Shark Research. Retrieved on May 5, 2010.
  38. ^ a b c Gelsleichter, J.; Musick, J.A. and Nichols, S. (February 1999). "Food habits of the smooth dogfish, Mustelus canis, dusky shark, Carcharhinus obscurus, Atlantic sharpnose shark, Rhizoprionodon terraenovae, and the sand tiger, Carcharias taurus, from the northwest Atlantic Ocean". Environmental Biology of Fishes 54 (2): 205–217. doi:10.1023/A:1007527111292. 
  39. ^ a b c d Hussey, N.E.; Cocks, D.T.; Dudley, S.F.J.; McCarthy, I.D. and Wintner, S.P. (2009). "The condition conundrum: application of multiple condition indices to the dusky shark Carcharhinus obscurus". Marine Ecology Progress Series 380: 199–212. doi:10.3354/meps07918. 
  40. ^ Martin, R.A. The Power of Shark Bites. ReefQuest Centre for Shark Research. Retrieved on August 31, 2009.
  41. ^ Gubanov, E.P. (1988). "Morphological characteristics of the requiem shark, Carcharinus obscurus, of the Indian Ocean". Journal of Ichthyology 28 (6): 68–73. 
  42. ^ Simpfendorfer, C.A.; Goodreid, A. and McAuley, R.B. (2001). "Diet of three commercially important shark species from Western Australian waters". Marine and Freshwater Research 52 (7): 975–985. doi:10.1071/MF01017. 
  43. ^ a b Smale, M.J. (1991). "Occurrence and feeding of three shark species, Carcharhinus brachyurus, C. obscurus and Sphyrna zygaena, on the eastern Cape coast of South Africa". South African Journal of Marine Science: 31–42. 
  44. ^ Cockcroft, V.G.; Cliff, G. and Ross, G.J.B. (1989). "Shark predation on Indian Ocean bottlenose dolphins Tursiops truncatus off Natal, South Africa". South African Journal of Zoology 24 (4): 305–310. 
  45. ^ Pratt, H.L. (Jr.) (1993). "The storage of spermatozoa in the oviducal glands of western North Atlantic sharks". Environmental Biology of Fishes 38: 139–149. doi:10.1007/BF00842910. 
  46. ^ a b c Natanson, L.J. and Kohler, N.E. (1996). "A preliminary estimate of age and growth of the dusky shark Carcharhinus obscurus from the South-West Indian Ocean, with comparisons to the western North Atlantic population". South African Journal of Marine Science 17: 217–224. doi:10.2989/025776196784158572. 
  47. ^ Dudley, S.J.F.; Cliff, G.; Zungu, M.P. and Smale, M.J. (2005). "Sharks caught in the protective gillnets off KwaZulu-Natal, South Africa. 10. The dusky shark Carcharhinus obscurus (LeSueur, 1818)". South African Journal of Marine Science 27 (1): 107–127. 
  48. ^ a b c White, W.T. (2007). "Catch composition and reproductive biology of whaler sharks (Carcharhiniformes: Carcharhinidae) caught by fisheries in Indonesia". Journal of Fish Biology 71 (5): 1512–1540. doi:10.1111/j.1095-8649.2007.01623.x. 
  49. ^ a b Simpfendorfer, C.A.; McAuley, R.B.; Chidlow, J. and Unsworth, P. (2002). "Validated age and growth of the dusky shark, Carcharhinus obscurus, from Western Australian waters". Marine and Freshwater Research 53 (2): 567–573. doi:10.1071/MF01131. 
  50. ^ McAuley, R.; Lenanton, R.; Chidlow, J.; Allison, R. and Heist, E. (2005). "Biology and stock assessment of the thickskin (sandbar) shark, Carcharhinus plumbeus, in Western Australia and further refinement of the dusky shark, Carcharhinus obscurus, stock assessment. Final FRDC Report - Project 2000/134". Fisheries Western Australia Fisheries Research Report 151: 1–132. 
  51. ^ a b c d e f Fowler, S.L.; Cavanagh, R.D.; Camhi, M.; Burgess, G.H.; Cailliet, G.M.; Fordham, S.V.; Simpfendorfer, C.A. and Musick, J.A. (2005). Sharks, Rays and Chimaeras: The Status of the Chondrichthyan Fishes. International Union for Conservation of Nature and Natural Resources. pp. 297–300. ISBN 2-8317-0700-5. 
  52. ^ Simpfendorfer, C.A. (Oct. 2000). "Growth rates of juvenile dusky sharks, Carcharhinus obscurus (Lesueur, 1818), from southwestern Australia estimated from tag-recapture data". Fishery Bulletin 98 (4): 811–822. 
  53. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on May 14, 2010.
  54. ^ Species of Concern: Dusky Shark. (Jan. 6, 2009). NMFS Office of Protected Resources. Retrieved on May 18, 2009.
  55. ^ Pank, M., Stanhope, M., Natanson, L., Kohler, N. and Shivji, M. (May 2001). "Rapid and Simultaneous Identification of Body Parts from the Morphologically Similar Sharks Carcharhinus obscurus and Carcharhinus plumbeus (Carcharhinidae) Using Multiplex PCR". Marine Biotechnology 3 (3): 231–240. doi:10.1007/s101260000071. PMID 14961360. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Garrick (1982) for synonymy.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!