Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

The Opah or Moonfish (Lampris guttatus) has a deep, laterally compressed oval body, with a long dorsal fin that rises high at its front end. The lateral line, on each side of the body, arches high toward the front. The pectoral fins are long and point straight up. The iridescent body is bluish above and pinkish below, usually with many white spots over much of the body. All fins, the eye ring, and the lips are scarlet. The jaws contain no teeth. The large pelvic fin has 14 to 17 rays. The scales are cycloid (a scale type with a smooth rear edge, making the scale smooth to touch) and tiny. Opah grow to ~140 cm (maximum reported ~180 cm) in length and ~75 kg (maximum reported ~ 225 to 270 kg).

Opah are found worldwide in subtropical and temperate seas (apparently avoiding equatorial waters), including the Mediterranean and Caribbean seas, from the surface to a depth of around 500 m. In the western Atlantic, they occur from the Grand Banks and Nova Scotia (Canada) to Florida, the Gulf of Mexico, and the West Indies. In the Pacific, they are found from Japan to the Gulf of Alaska and the Gulf of California. The Opah is one of only two species in the family Lampridae (the other being Lampris immaculatus, a rare species of the southern oceans south of 30º S that has a more elongate body, lacks pale spotting on the body, and has the ventral fin originating well behind the pectoral fin; Heemstra 2003). Opah consume a variety of pelagic animals, including squids, crabs, fish, jellyfish, and small crustaceans. They are sometimes caught by salmon and Albacore fishermen and on tuna longlines. The flesh is mostly salmon-colored, but darker over the pectoral fin. It is said to be dry but tasty and excellent when smoked. The superficially similar Ocean Sunfish (Mola mola) has no pelvic fins or red pigment, has a tiny gill opening, and has no evident caudal (tail) fin.

(Eschmeyer and Herald 1983; Robins and Ray 1986; Heemstra and Heemstra 2004)

For additional information on Opah, visit the NOAA-NMFS FishWatch page and the Monterey Bay Aquarium’s SeafoodWatch page.

  • Eschmeyer, W.N. and E.S. Herald. 1983. A Field Guide to Pacific Coast Fishes of North America. Houghton Mifflin, Boston.
  • Heemstra, P.C. 2003. Lampridae. p. 398 in Smiths’ Sea Fishes (M.M. Smith and P.C. Heemstra, eds.). Struik Publishers, Cape Town, South Africa. [This version first published by Macmillan South Africa, Johannesburg, in 1986]
  • Heemstra, P.C. and E. Heemstra. 2004. Coastal Fishes of Southern Africa. South African Institute for Aquatic Biodiversity and National Inquiry Service Centre, Grahamstown, South Africa.
  • Polovina, J. J., Hawn, D., and M. Abecassis. 2008. Vertical movement and habitat of opah (Lampris guttatus) in the central North Pacific recorded with pop-up archival tags. Marine Biology 153: 257- 267.
  • Robins, C. R. and G.C. Ray. 1986. A Field Guide to Atlantic Coast Fishes of North America. Houghton Mifflin, Boston.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Oceanic and apparently solitary (Ref. 6737). Epi- and mesopelagic (Ref. 58302). Feeds on midwater fishes and invertebrates, mainly squids (Ref. 6737). Probably spawns in the spring (Ref. 6885). Occasionally taken as a by-catch of tuna fisheries. Considered a good food fish (Ref. 5242); marketed fresh and frozen; prepared as sashimi (Ref. 9987). Swims by flapping the pectoral fins (Ref. 36731).
  • Palmer, G. 1986 Lamprididae. p. 725-726. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. UNESCO, Paris. Vol. 2. (Ref. 6737)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Grand Banks and Nova Scotia (Canada) to Florida (USA), Gulf of Mexico and the West Indies
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Worldwide in tropical to temperate waters (Ref. 57923). Western Atlantic: Grand Banks and Nova Scotia (Canada) to Florida (USA), Gulf of Mexico and the West Indies (Ref. 7251) up to Argentina (Ref. 47377). Eastern Atlantic: Norway and Greenland to Senegal (Ref. 6737) and south of Angola (Ref. 6476) also Mediterranean. Eastern Pacific: Gulf of Alaska to south of southern California (Ref. 265). A single capture in South Georgia marks an incidental occurrence in Southern Ocean.
  • Palmer, G. 1986 Lamprididae. p. 725-726. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. UNESCO, Paris. Vol. 2. (Ref. 6737)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in subtropical and temperate seas (including Mediterranean Sea, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Open waters of the Atlantic and Pacific Oceans; Western Atlantic: Newfoundland, Nova Scotia, Maine, USA, Cape Cod, and Cuba. Eastern Atlantic: Madeira, Scandinavia, the British Isles, and Iceland; Gulf of Mexico: off the west coast of Florida.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Hart, J.L., 1973; Palmer, G., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 48 - 55; Analspines: 0; Analsoft rays: 33 - 41; Vertebrae: 43
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

200 cm TL (male/unsexed; (Ref. 5188)); max. published weight: 270.0 kg (Ref. 5188)
  • Gon, O. 1990 Lampridae. p. 215-217. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 200.0 cm TL (male/unsexed); max. weight: 270 kg .
  • Bigelow, H.B. and W.C. Schroeder, 1953; Hart, J.L., 1973; Palmer, G., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal fin broadly lunate; pectorals long and falcate; pelvic fins similar to pectoral fins in shape and a little longer (Ref. 6885). Dark steely blue dorsally shading into green with silver and purple iridescence, belly rosy, body covered with silvery spots in irregular rows, light mottling on caudal and dorsal fins; vermillion on fins and jaws, golden around eyes (Ref. 6885).
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

oceanic and apparently solitary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; oceanodromous (Ref. 51243); marine; depth range 100 - 500 m (Ref. 89422), usually ? - 366 m (Ref. 5951)
  • McMillan, P.J., M.P. Francis, G.D. James, L.J. Paul, P.J Marriott, E. Mackay, B.A. Wood, L.H. Griggs, H. Sui and F. Wei 2011 New Zealand fishes. Volume 1: A field guide to common species caught by bottom and midwater fishing. New Zealand Aquatic Environment and Biodiversity Report No. 68. 329 p. (Ref. 89422)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Scott, W.B. and M.G. Scott 1988 Atlantic fishes of Canada. Can. Bull. Fish. Aquat. Sci. 219:731 p. (Ref. 5951)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 33 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 22 - 5057
  Temperature range (°C): 1.424 - 12.823
  Nitrate (umol/L): 6.408 - 34.219
  Salinity (PPS): 34.311 - 35.701
  Oxygen (ml/l): 3.439 - 6.313
  Phosphate (umol/l): 0.441 - 2.386
  Silicate (umol/l): 2.954 - 136.913

Graphical representation

Depth range (m): 22 - 5057

Temperature range (°C): 1.424 - 12.823

Nitrate (umol/L): 6.408 - 34.219

Salinity (PPS): 34.311 - 35.701

Oxygen (ml/l): 3.439 - 6.313

Phosphate (umol/l): 0.441 - 2.386

Silicate (umol/l): 2.954 - 136.913
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 100 - 400m.
From 100 to 400 meters.

Habitat: bathypelagic. Body pink to purple with numerous white spots; fins and front of snout red; small juveniles without white spots on body. Attains 180 cm and 100 kg. Flesh excellent; the enormous pectoral fin muscles are dark red and resemble a fine beef-steak in texture and flavour. A member of the lower epipelagic community, the opah feeds on squid and fishes (including some benthic species) and is usually found well offshore. It is a swift swimmer, flapping its strong pectoral fins in the manner of a penguin to "fly" through the water. The opah is found in all oceans, including the Mediterranean and Caribbean seas, but not in polar waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bathypelagic; marine; depth range 100 - 400 m. Oceanic and apparently solitary.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Hart, J.L., 1973; Palmer, G., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Midwater fishes and invertebrates, mainly squids.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Hart, J.L., 1973; Palmer, G., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on midwater fishes and invertebrates, mainly squids
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Probably spawns in the spring.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Hart, J.L., 1973; Palmer, G., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lampris guttatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCGATGATTTTTCTCAACCAATCACAAGGACATTGGCACCCTGTATCTAGTATTTGGGGCCTGAGCTGGAATGGTCGGAACTGCCCTCAGCCTTCTAATCCGAGCTGAGCTCAGCCAACCAGGAGCCCTCCTGGGAGAC---GACCAAATCTATAACGTAATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTTATAGTCATGCCCATCATAATTGGAGGCTTTGGGAACTGGCTAATTCCCTTAATAATCGGCGCCCCTGACATGGCCTTTCCCCGAATGAACAATATAAGCTTCTGGCTTCTTCCCCCCTCCTTCTTACTCCTTCTAGCCTCCTCCGGAGTAGAGGCCGGGGTAGGAACAGGCTGAACCGTATACCCACCCCTAGCAGGAAACCTAGCTCACGCAGGAGCCTCAGTTGACCTAGCCATTTTCTCCCTTCACCTAGCAGGGGTCTCCTCTATTTTAGGGGCAATCAACTTTATTACCACAATTATCAACATGAAGCCTCCGGCCATCTCTCAGTACCAAACCCCCCTCTTCGTATGGGCCACCCTGATTACGGCTGTACTCCTTCTCCTCTCCCTCCCCGTTTTAGCTGCCGGAATTACAATGCTCCTAACAGATCGAAACCTGAATACTACTTTCTTTGACCCTTCCGGGGGAGGAGACCCCATTCTATATCAGCATCTATTCTGATTCTTCGGGCACCCTGAGGTCTATATTCTCATCCTACCTGGCTTTGGAATAATCTCCCATATCGTGGCCTACTACTCAGGTAAGAAAGAGCCCTTCGGCTACATAGGAATAGTTTGAGCTATAATGGCCATTGGCCTTCTAGGGTTTATTGTCTGAGCCCACCACATGTTTACGGTGGGGATGGACGTAGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lampris guttatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: very high; price reliability: reliable: based on ex-vessel price for this species
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lampris guttatus

Lampris guttatus (common names opah, cravo, moonfish, kingfish, and Jerusalem haddock) is a large, colorful, deep-bodied pelagic lampriform fish belonging to the family Lampridae, which comprises the genus Lampris, with two extant species. It is a pelagic fish with a worldwide distribution. While it is common to locations such as Hawaii[2] and west Africa, it remains uncommon in others, including the Mediterranean.[3] In the places where L. guttatus is prevalent, it is not a target of fishing, though it does represent an important commercial component of bycatch. In Hawaiian longline fisheries, it is generally caught on deep sets targeting big-eye tuna. In 2005, the fish caught numbered 13,332. In areas where the fish is uncommon, such as the Mediterranean, its prevalence is increasing. Some researchers believe this a result of climate change.[3] Much is still unknown about the distribution, interactions, life histories, and preferred habitats of this fish and other medium to large-sized pelagic fishes. To better implement ecosystem-based, spatially structured fishery management approaches, this must be changed.[4]

Etymology[edit]

The genus name Lampris is derived from the Greek word lampros, meaning "brilliant" or "clear", while the Latin species name guttatus means spotted and refers to the spotted body of this fish.

Description[edit]

Researchers examine and later release an opah caught off California

Lampris guttatus is a large discoid and deeply keeled fish with an attractive form and a conspicuous coloration. They usually reach a maximum length of 2 m (6.6 ft) and a maximum weight of 270 kg (600 lb).

The body is a deep steely blue grading to rosy on the belly, with white spots in irregular rows covering the flanks. Both the median and paired fins are a bright vermillion. Jaws are vermillion, too. The large eyes stand out as well, ringed with golden yellow. The body is covered in minute cycloid scales and its silvery, iridescent guanine coating is easily abraded.

They have long falcated pectoral fins inserted (more or less) horizontally. The caudal fins are broadly lunated, forked, and emarginated. Pelvic fins are similar but a little longer than pectoral fins, with about 14–17 rays.

The anterior portion of a dorsal fin (with about 50–55 rays) is greatly elongated, also in a falcate profile similar to the pelvic fins. The anal fin (34–41 rays) is about as high and as long as the shorter portion of the dorsal fin, and both fins have corresponding grooves into which they can be depressed. The snout is pointed and the mouth small, toothless, and terminal. The lateral line forms a high arch over the pectoral fins before sweeping down to the caudal peduncle.

Habitat and distribution[edit]

L. guttatus has a worldwide distribution, from the Grand Banks to Argentina in the Western Atlantic, from Norway and Greenland to Senegal and south to Angola (also in the Mediterranean) in the Eastern Atlantic, from the Gulf of Alaska to southern California in the Eastern Pacific, in temperate waters of the Indian Ocean, and rare forays into the Southern Ocean.

This species is presumed to live out their entire lives in the open ocean, at mesopelagic depths of 50–500 m, with possible forays into the bathypelagic zone. Typically, it is found within water at 8 to 22 °C.[2] To better understand the depths L. guttatus inhabited in the tropical and temperate ocean waters, a study was performed, tagging them in the central North Pacific. Their location was found to be related to a temporal scale, inhabiting depths of 50-100 m during the night and 100-400 m during the day. The depths of the vertical habitat varied with local oceanogeographic conditions, though the patterns of deeper depths during the day is universal to the species.[4]

Behavior[edit]

The life history and development of L. guttatus still remain rather uncertain.[5][full citation needed] They are apparently solitary, but are known to school with tuna and other scombrids. They propel themselves by a lift-based mode of swimming, that is, by flapping their pectoral fins. This, together with their forked caudal fins and depressible median fins, indicates they swim at constantly high speeds. Squid and krill make up the bulk of their diet; small fish are also taken.

They probably spawn in the spring. Their planktonic larvae lack of dorsal and pelvic fin ornamentation. The slender hatchlings later undergo a marked and rapid transformation from a slender to deep-bodied form; this transformation is complete by 10.6 mm standard length.

Like many other large pelagic visual predators, such as swordfish and big-eye tuna, it exhibits vertical behavior. Its speeds have found to be more than 25 cm/s, and on one occasion one was witnessed to have a burst of speed of 4 m/s.[2]

One of the evolutionary adaptations of L. guttatus is cranial endothermy, the ability to generate and maintain metabolic heat in the cranial and optic regions at 2°C warmer than the rest of the body.[6] This is important for maintaining brain and eye function during the wide range of temperatures it experiences with its vertical movements.[7]

Based on those caught off the Hawaiian coast, the diet of L. guttatus appears to be a squid-based. Those caught along the Patagonia Shelf also showed a narrow range of prey items, the most common of which was the deepwater onychotenhid squid (Morotenthis ingens).[2]

See also[edit]

References[edit]

  1. ^ Fish Base
  2. ^ a b c d Polovina, Jeffrey J.; Hawn, Donald; Abecassis, Melanie (2008). "Vertical movement and habitat of opah (Lampris guttatus) in the central North Pacific recorded with pop-up archival tags". Marine Biology 153 (3): 257–267. doi:10.1007/s00227-007-0801-2. ISSN 0025-3162. 
  3. ^ a b Francour, Patrice; Cottalorda, Jean-Michel; Aubert, Maurice; Bava, Simone; Colombey, Marine; Gilles, Pierre; Kara, Hichem; Lelong, Patrick; Mangialajo, Luisa; Miniconi, Roger; Quignard, Jean-Pierre (2010). "Recent Occurrences of Opah, Lampris guttatus (Actinopterygii, Lampriformes, Lampridae), in the Western Mediterranean Sea". Acta Ichthyologica Et Piscatoria 40 (1): 91–98. doi:10.3750/AIP2010.40.1.15. ISSN 0137-1592. 
  4. ^ a b Richardson, David E.; Llopiz, Joel K.; Guigand, Cedric M.; Cowen, Robert K. (2010). "Larval assemblages of large and medium-sized pelagic species in the Straits of Florida". Progress in Oceanography 86 (1-2): 8–20. doi:10.1016/j.pocean.2010.04.005. ISSN 0079-6611. 
  5. ^ (Oelschlaeger H. 1976).
  6. ^ Bray, Dianne. "Opah, Lampris guttatus". Fishes of Australia. Retrieved 16 September 2014. 
  7. ^ Runcie R. 2006. Cranial endothermy in the moonfish (Lampris guttatus)
  • Biolib
  • Aquatab
  • Opah NOAA FishWatch. Retrieved 11 November 2012.
  • Parin NV and Kukuev EI. 1983. Reestablishment of the validity of lampris immaculata gilchrist and the geographical distribution of lampridae. Voprosy Ikhtiologii.Moscow 23(1):3-14.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!