Overview

Brief Summary

Biology

Hogfish have a fascinating life history; they are protogynous hermaphrodites, meaning that individuals first function sexually as females and then later, upon reaching a larger size, transform into males (4). This change generally occurs at around three years of age and a length of about 35 centimetres (4). Hogfish form harems; groups of females dominated by a larger male. The male and the females simultaneously release gametes into the surrounding water where fertilization occurs. The fertilized eggs develop quickly into larvae, a stage which lasts several weeks until they grow into juveniles. Off the coast of Florida, this spawning event occurs during February and March (4). Hogfish forage during the day, feeding primarily on gastropods and bivalve molluscs, but also on crabs, sea urchins, and barnacles (2). It can use its long snout and protractible mouth to root in the sand for its favoured prey (3). Hogfish may live for up to 11 years (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The hogfish gets its unusual name from its long, pig-like snout and protrusible mouth which it uses to root around the sea bottom for food (3) (4). The hogfish belongs to the second largest family of marine fishes, the wrasses, but instead of a cigar-shaped body like most wrasses, the hogfish is laterally compressed and round (2) (4). The colour of the hogfish is highly variable, and depends on age, sex and habitat (4). Generally they are pearly white and mottled with reddish-brown (4). Small hogfish may be uniformly grey, whilst large hogfish can be mostly salmon pink, with a dark maroon bar on top of the snout (2). Most individuals possess a prominent round, black blotch below the dorsal fin, yellowish pectoral fins and bright red eyes (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Lachnolaimus maximus (Walbaum, 1792)

Materials

Type status: Other material. Occurrence: catalogNumber: CIRR-303 ; recordedBy: Salvador Zarco Perello ; individualCount: 2 ; Location: continent: America; country: Mexico ; stateProvince: Yucatan; locality: Madagascar Reef ; verbatimDepth: 5 m; verbatimLatitude: 780535.103072; verbatimLongitude: 2373608.16789; verbatimCoordinateSystem: UTM 15N; verbatimSRS: WGS84; decimalLatitude: 21.443068 ; decimalLongitude: -90.293373 ; Event: samplingProtocol: Photosampling ; eventDate: 20/9/2007 ; Record Level: collectionID: YUC-PEC_239-01-64; institutionCode: UMDI-SISAL ; collectionCode: CIRR

Distribution

Western Atlantic. North Carolina to Brazil. Including Bermuda, Bahamas and throughout the Caribbean Islands.

  • Zarco Perello, Salvador, Moreno Mendoza, Rigoberto, Simoes, Nuno (2014): Checklist of Fishes from Madagascar Reef, Campeche Bank, Mexico. Biodiversity Data Journal 2, 1100: 1100-1100, URL:http://dx.doi.org/10.3897/BDJ.2.e1100
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A large and economically valuable species, monandric and a protogynous hermaphrodite (Ref. 93709). Adults are found over open bottoms or coral reef areas (Ref. 5217). Often encountered where gorgonians are abundant (Ref. 13442). Feed mainly on mollusks, also crabs and sea urchins (Ref. 3726). Flesh highly esteemed; marketed fresh and frozen (Ref. 3726). Have been reared in captivity (Ref. 35420).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description: Body relatively thin, short and wide with a large eye and a terminal, small mouth. Pectoral and pelvic fins short. Dorsal and anal-fin bases relatively long, caudal peduncle short and wide. By the time the fin-ray complement has formed, around 5.5 mm SL, melanophores are scattered over the body and in three discrete patches along the anal-fin base. Subsequently, melanophores develop in bars radiating from the eye: forward across the jaw, a vertical below the eye, and in bands across the top of the head. A reticulated pattern of melanophores then develops over the body. Since the larvae were raised in captivity, the point of transition cannot be determined. Series of larvae shows the eye remains round.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Lachnolaimus maximus is present in the Caribbean and north to Bermuda and the Carolinas and extends southwards to the northern region of the Brazilian Coast.

This species is present in the following countries: Anguilla; Antigua and Barbuda; Aruba; Bahamas; Barbados; Belize; Bermuda; Canada; Cayman Islands; Colombia; Costa Rica; Cuba; Dominica; Dominican Republic; French Guiana; Grenada; Guadeloupe; Guatemala; Guyana; Haiti; Honduras; Jamaica; Martinique; Mexico; Montserrat; Netherlands Antilles (Curaçao); Nicaragua; Panama; Puerto Rico; Saint Kitts and Nevis; Saint Lucia; Saint Vincent and the Grenadines; Suriname; Trinidad and Tobago; Turks and Caicos Islands; United States; Venezuela; Virgin Islands, British; Virgin Islands, U.S., NE Brazil (Floeter et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: from Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to northern South America.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Nova Scotia (Canada), Bermuda, and northern Gulf of Mexico to northern South America.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in the western Atlantic, from North Carolina and Bermuda, south to the Gulf of Mexico and the northern coast of South America (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 10
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

91.0 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 11.0 kg (Ref. 36052); max. reported age: 23 years (Ref. 93706)
  • McBride, R.S. and A.K. Richardson 2007 Evidence of size-selective fishing mortality from an age and growth study of hogfish (Labridae: Lachnolaimus maximus), a hermaphroditic reef fish. Bull. Mar. Sci. 80(2):401-417. (Ref. 93706)
  • Randall, J.E. and G.L. Warmke 1967 The food habits of the hogfish (Lachnolaimus maximus), a labrid fish from the Western Atlantic. Caribb. J. Sci. 7(3-4):141-144. (Ref. 36052)
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: The fin-ray count of D-XIV,11 A-III,10 indicates Lachnolaimus maximus. I have not collected this species, but Colin (1982) raised the larvae through their larval phase. The larvae resemble Doratonotus megalepis in basic form, but develop surface melanophores early in development, around the time the fin rays are fully formed (about 5 mm SL). This feature is particularly unusual for labrids (or other labroids) and it is likely that this species is the sole member of the family to have body pigmentation (none of the Indo-Pacific labroid larvae identified by Leis and Carson-Ewart (2000) have this character). The adaptation suggests that larval L. maximus are associated with drift algae and not exposed in the plankton.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Deep-bodied wrasse with a strongly arched dorsal profile. First 3 dorsal spines filamentous. Only wrasse with elongate dorsal spines and such a highly arched profile (Ref. 26938). Color variable but generally mottled brownish red with a black spot at rear base of dorsal fin (Ref. 13442).
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Analogues: In most features this larval type resembles larval Doratonotus megalepis, but is distinguished by a slightly different fin-ray count and, most conspicuously, by having extensive melanophore patterns on the body. The arrangement of melanophores on the head resembles that of transitional D. megalepis and they share the markings on the first dorsal-fin spines and pelvic fins, but even late transitional D. megalepis do not have the reticulated patterns on the body.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Lachnolaimus maximus is found on coral reefs at 3-40 m depth, especially sandy outer reef slopes. Juveniles are most common in shallow seagrass, and inshore reef habitats.

It is a monadric protogynous hermaphrodite (McBride and Johnson 2007) with a very slow rate of sex change (several months that occurs post spawning). It has an extended spawning season from January to May. In Florida, females attain sexual maturity at two years 26.0 cm (FL), sexual transition at three to five years but recorded in individuals up to 13 years. Reproductive aggregations have been observed in Los Roques (J.H. Choat pers. comm. 2008).

There is considerable variation in growth and age structure over the geographic range of this species. The most detailed account (McBride and Richardson 2007) compared growth and age structure of populations from the eastern Gulf of Mexico and southern Florida (Easten Gulf of Mexico - max. age 23 years; max. size 82.4 cm (FL); von Bertalanffy Growth Function Linf 91.7 cm; k .014; mortality rate 0.35, and South Florida - max. age 13 years; Max size 62.2 cm (FL); von Bertalanffy Growth Function Linf 42.8 cm; k .045 mortality rate 0.4).

A broader survey of four Atlantic locations revealed the following: (J.H. Choat pers. comm. 2008) Margarita (Venuezula) - max. age five years, max. size 35.3 cm; Los Roques (Ven) - max. age10 years, max. size 68.7 cm; Belize - max. age seven years max. size 55.4 cm; Bermuda - max. age 16 years, max. size 84.4 cm. In addition, mortality rates estimates from catch curves from Margarita and Belize (0.8, 0.7) both heavily fished, were double those from Los Roques and Bermuda where only light fishing occurs.

All populations examined for age distribution in the Eastern Gulf of Mexico, South Florida, (McBride and Richardson 2007) Belize, Los Roques, Bermuda, Margarita (J.H. Choat pers. comm. 2008) revealed that distribution was strongly skewed to the younger age classes varying from one to four years. Abundance estimates by Underwater Visual Census in Belize and Los Roques (J.H. Choat pers. comm. 2008) revealed low densities (0.81-0.95 individuals per 1,000 m2). No counts of aggregations were made.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 30 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 336 specimens in 1 taxon.
Water temperature and chemistry ranges based on 232 samples.

Environmental ranges
  Depth range (m): 0.5 - 279
  Temperature range (°C): 8.744 - 28.067
  Nitrate (umol/L): 0.125 - 21.356
  Salinity (PPS): 35.123 - 36.509
  Oxygen (ml/l): 3.466 - 4.728
  Phosphate (umol/l): 0.046 - 1.467
  Silicate (umol/l): 0.805 - 15.381

Graphical representation

Depth range (m): 0.5 - 279

Temperature range (°C): 8.744 - 28.067

Nitrate (umol/L): 0.125 - 21.356

Salinity (PPS): 35.123 - 36.509

Oxygen (ml/l): 3.466 - 4.728

Phosphate (umol/l): 0.046 - 1.467

Silicate (umol/l): 0.805 - 15.381
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 30m.
From 3 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The hogfish inhabits inshore patch reefs and seaward reefs, at depths of 3 to 30 meters. It prefers areas with abundant growth of gorgonian corals (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found over open bottoms or coral reef areas (Ref. 5217). Often encountered where gorgonians are abundant (Ref. 13442). Feeds mainly on mollusks, also crabs and sea urchins (Ref. 3726). Mobile invertebrate feeder (Ref. 57616).
  • Bardach, J.E. 1959 The summer standing crop of fish on a shallow Bermuda Reef. Limnol. Oceanogr. 4:77-85. (Ref. 4950)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Monandric (no primary males) , protogynous hermaphrodites. Sex change is postmaturation; it is initiated among individuals 30-40 cm LF (or 3-5 yrs) but was also observed in fish as large as 69.4 cm LF (13 yrs). Sex change occurred after one more spawning (as a female) seasons and requires several months to complete (Ref.74380). Harem spawner (Ref.74381). Spawning activity is characterised by the following event called 'spawning rush': 1) pectoral swim up, 2) tail swim, 3) swin alongsode and tilt, 4) release, 5) circle and display, and 6) swim down (Ref. 74381).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lachnolaimus maximus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGCACAGCCTTGAGCCTTCTCATTCGAGCAGAACTAAGCCAACCAGGCGCCCTTCTAGGGGACGACCAGATTTATAACGTCATTGTTACGGCGCATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTTATCCCACTAATAATTGGAGCCCCTGACATGGCTTTCCCCCGAATAAACAACATAAGCTTTTGACTCCTCCCACCTTCATTTCTTCTCCTCTTGGCATCCTCAGGGGTAGAAGCCGGGGCTGGCACCGGATGAACAGTTTACCCCCCGTTAGCAGGCAATTTAGCCCATGCAGGGGCCTCTGTTGATCTAACCATCTTTTCTCTGCATCTAGCAGGCATTTCTTCAATTCTTGGAGCAATTAATTTTATTACAACCATTATTAATATGAAACCCCCCGCCATCTCCCAATATCAGACCCCGCTGTTTGTTTGGGCAGTTCTAATTACAGCAGTGCTCCTGCTCCTGTCCCTTCCTGTCCTTGCTGCTGGAATTACAATGCTCTTAACAGACCGAAACCTAAACACCACCTTCTTTGACCCCGCAGGAGGGGGAGACCCAATTCTATATCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lachnolaimus maximus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd

Version
3.1

Year Assessed
2010

Assessor/s
Choat, J.H., Pollard, D. & Sadovy, Y.J.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
Lachnolaimus maximus has been assessed as Vulnerable under criterion A2ad. Although this species has a wide distribution; the level of recreational spear-fishing is estimated to have caused a 30% decline in global population, with particular localized declines as high as 60% (Florida). This decline is thought to have occurred over three generations, which qualifies it for Vulnerable status. Although regulations including maximum size, and gear restrictions have been introduced across the Caribbean the threat from exploitation has not ceased. Further information on population and harvesting levels are required (in particular monitoring of CPUE data) to allow assessment of population trends and threat levels in to the future.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In the past Lachnolaimus maximus had moderate abundance over shallow west Atlantic coral reefs, but is now depleted in many areas due to fishing. Large populations are maintained at only a few sites including Los Roques (Venezuela), Bermuda and at some sites in the Florida Keys (J.H. Choat pers. comm. 2008). Overall the population has declined over most of its range.

Ault et al. (2003) report high harvesting rates for Florida with declining returns of 272 metric t in 1987 to 154 metric t in 1993 and averaging 93 metric t from 1998-2001. This represents a decline of approximately 60% over a period of 14 years. The declines are still continuing (J.H. Choat pers. comm. 2008). Considering together all catch and census data on the species from throughout its geographic range, it is clear that declines of at least 30% must have occurred within the last few generations (Y. Sadovy pers. comm. 2009).

This species is another of the large hypsigenyine labrids that reaches a large size but has very low population densities. At Los Roques aggregations of approximately 50 large individuals were found on shallow sandy slopes (J.H. Choat pers. comm. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Lachnolaimus maximus is harvested as a food source although is of minor commercial importance and is mainly caught using hook and line. It is marketed as the 'Hog Snapper'. This species has been implicated in ciguatera (Robins et al. 1986). The 2005 total landings of L. maximus were 13% lower than the average landings over the previous five years (2000-2004) and were 42% lower than the historic average landings (1982-2005) (FWRI 2006). The latest stock assessment (SEDAR and SAFMC 2004) indicated that the hogfish fishery was severely overfished and has been for the last two decades in Florida waters (FWRI 2006). This has impacted upon the growth and recruitment of this species.

Coral reefs of the Caribbean had been heavily damaged by disease, coastal development, coral bleaching, and over-fishing. It is predicted that reefs away from population centres will remain healthy in the future, unless the adverse predictions for global climate change, of more tropical storms and bleaching occur (Andrews et al. 2004). Lachnolaimus maximus is also a common species within the aquarium trade.

Fishing pressure on this species has increased since the 1970s (Bohnsack et al. 1994) it is possible the size at maturity could decrease over time (McBride 2001). This species is currently in decline around Puerto Rico (Ojeda-Serrano et al. 2007). The estimated number of hogfish landed between 1980 and 1992 in the Monroe County area fell from 180,917 to 21,813 (Bohnsack et al. 1994). These figures fluctuated in this time period but demonstrated an overall decline.

Tupper and Rudd (2002) found that fishing pressure and depth had a marked influence on hogfish length, density and biomass, with these attributes being significantly higher on deeper reefs. In fished areas the length, density and biomass of hogfish were all significantly lower when compared to a nearby protected area. Catch per unit effort (CPUE) was much lower (half or less) in the fished zone when compared to lightly-fished or protected zones.
Although there is evidence of exploitation across this species' range the reasons behind them are understood and reversible (H. Choat pers. comm. 2009). Also, overfishing does not seem to have had an impact on recruitment (H. Choat pers. comm. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2bd), IUCN Grouper and Wrasse Specialist Group
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hogfish are sought after by humans (2), due to their apparently unique taste and flavour (5). Unfortunately, this has led to fishing pressure that has reduced many populations to critically low levels (5), and the hogfish is now vulnerable to extinction (1). In Florida, where the fish is economically important to both commercial and recreational fisheries, there are indications that the hogfish stock has been overfished for more than a decade (5). Juvenile hogfish are also sometimes captured for the aquarium trade (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The South Atlantic Fishery Management Council (SAFMC) have established regulations for removal of Lachnolaimus maximus for both commercial and recreational purposes. These include a maximum landing size of 30.5 cm, gear restrictions, and a daily bag allowance of five hogfish per day for recreational fishers. There are a number of no-take zones in the Caribbean and total fishing is restricted to just over 300,000 ha of the wider Caribbean.

Ault et al. (2003) suggest restricting recreational fishing in particular areas by limiting the use of SCUBA gear with spear fishing and/or limiting the amount of time during a year that spear fishing may be undertaken. Further research and monitoring of the harvest levels and population numbers of this species is needed to ensure that any future population declines are noted.

Catch per unit effort (CPUE) was much lower (half or less) in the fished zone when compared to a lightly-fished or protected zone. CPUE of hogfish decreased with increasing distance from the reserve, which suggests that spillover from the protected area can enhance the local fishery yields outside its boundaries. This indicates increasing the area covered by protected zones would benefit this species (Tupper and Rudd 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

An assessment of the Florida stock led to the recommendation that the minimum size limit of hogfish that are captured in fisheries should be raised (5), which would reduce the pressure on the Florida stock. There have also been successful attempts at raising hogfish in captivity, and it is hoped that aquaculture will eventually reduce the fishing pressure on natural stocks of this intriguing fish (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p. (Ref. 9210)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hogfish

For other species known as hogfish, see Bodianus.

Lachnolaimus maximus, the hogfish, is a species of wrasse native to the western Atlantic Ocean, with a range from Nova Scotia, Canada to northern South America, including the Gulf of Mexico. This species occurs around reefs, especially preferring areas with plentiful gorgonians. This species is currently the only known member of its genus.[2]

Characteristics[edit]

The hogfish is characterized by a large, laterally compressed body shape. It possesses a very elongated snout which it uses to search for crustaceans buried in the sediment. Interestingly, this very long “pig-like” snout and its rooting behavior give the hogfish its name. The caudal or tail fin is somewhat lunate and the pectoral fins are along the lateral sides of the body with the paired pelvic fins directly below. A prominent black spot behind the pectoral fins differentiates males from females. The dorsal fin usually is composed of three or four long dorsal spines followed by a series of shorter dorsal spines. It is a carnivore. It mainly feeds on other small fish[citation needed].

Lifecycle[edit]

Like many wrasses, the hogfish is a sequential hermaphrodite, which means it changes sex during different life stages. The hogfish is a protogynous, “first female” hermaphrodite: juvenile hogfish start out as female and then mature to become male. The change usually occurs around three years of age and about 14 inches in length.[3] Females and juveniles will usually start out as pale gray, brown, or reddish brown in color, with a paler underside and no distinct patterns. Males are distinguished by a deep, dark band spanning from the snout to the first dorsal spine, as well as by a lateral black spot behind the pectoral fins. Hogfish reach a maximum of 91 cm (36 in) in total length and about 11 kg (24 lb) and have been recorded to live up to 11 years.[4] Spawning in South Florida occurs from November through June.[5] Hogfish social groups are organized into harems where one male will mate and protect a group of females in his territory.

Economic importance[edit]

Hogfish is a commonly targeted species for many spear and reef fisherman and is regarded highly by many for its taste and food value. In 2007, the Florida landings of hogfish totaled 306,953 pounds..[6] The fish stocks are regulated by the South Atlantic Fishery Management Council and Florida Fish and Wildlife Conservation Commission. Bag, size, and gear limits all have been placed on this species to ensure a healthy stock and to protect it from overfishing.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!