Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in lagoon patch reefs, the upper slopes of channels, and reef margins (Ref. 1602). Carnivorous (Ref. 81697). Nothing has been published on its biology. Solitary (Ref 90102).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

General
Epinephelus spilotoceps has a widespread, primarily insular, tropical Indo-West Pacific distribution.

Specific
Central East African coast (Kenya, Tanzania, Mozambique); Madagascar and all main tropical Western Indian Ocean Islands including Mauritius, Comoros, Seychelles, Chagos; Maldives; Laccadives, Andaman and Nicobar Islands (India); and other islands throughout the tropical Indian Ocean, and off southern Myanmar, western Thailand and Malaysia, Indonesia, southern Philippines (?), northern Papua New Guinea, Rowley Shoals to Scott Reef (off NW Western Australia), GBR and Coral Sea off northeast Australia and eastwards across the Western Pacific Ocean via Micronesia and Polynesia to the Line Islands. Except for its occurrence along the East African coast, it seems to be a primarily insular species, probably occurring around most or all of the islands of the tropical Indian and Western Pacific Oceans.

* Contrary to Heemstra and Randall (1993), this species does occur around the coral reefs and islands of the Great Barrier Reef and Coral Sea off NE Australia (Zool. Cat. Aust., Vol 35, Fishes); www2.dpi.qld.gov.au/fishguide/15744.html).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West-Pacific: East coast of Africa to the Line Islands. Except for its occurrence along the African coast (Zanzibar, Tanzania to Ponta Zavora, Mozambique) it seems to be primarily an insular species, occurring at most (probably all) of the islands of tropical Indian and west-central Pacific. Not known from the Red Sea, Persian Gulf, Sri Lanka, Philippines, Taiwan, Japan, or Australian waters (however, it is found at Rowley Shoals off Western Australia).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Madagascar and western Mascarenes east to Wake, Marshall Islands, Tonga and Cook Islands, south to Rowley Shoals (Western Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 16; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 30874))
  • Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in lagoon patch reefs, the upper slopes of channels, and reef margins (Ref. 1602). Nothing has been published on its biology.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preopercle rounded, with a shallow notch; the serrae are enlarged but covered with skin; upper edge of the operculum almost straight. The head and body mostly covered with close-set dark brown, olive, or reddish brown spots. Those on the dorsolateral parts of the head, body, and on median fins polygonal and close-set, with the interspaces forming a white reticulum. Those on the ventral portions are more rounded, more separated and often more reddish. Three dark blotches are often visible at the base of the dorsal fin and one forming a saddle blotch on the caudal peduncle. These blotches differentiates it from E. merra and E. quoyanus (Ref. 5222). Small conspicuous dark spots on snout and sometimes between or below the eyes (Ref. 37816).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Epinephelus spilotoceps
Catalog Number: USNM 141901
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, lagoon reef off Namu Island., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141908
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, Ourukaen Island (Code Name: Oruk) outer reef (on SW side of island)., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141906
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, outside reef of Yurochi (Code name: Yuro) Island-- near center of island; the Ilithothamnium ridge is about 1 mile out, so the station was run near the island in one of the deeper areas., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 5
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141918
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll, Enybarbar Island, Shallow pond like isolated tidal pool at southern end of Enyubarbar Island., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141910
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald & V. Brock
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, at NW Section of Reer Island, lagoon reef., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 3
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141917
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Eniwetok Atoll, Aaraanbiru (Arambiru) Island Ocean reef among coral heads of abundant growth., Eniwetok Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141920
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz & E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongerik Atoll, Eniwetak Island, ocean reef in surf and on reef., Rongerik Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141919
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz & E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongerik Atoll, Bock Island, ocean reef near middle of sand spit., Rongerik Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141909
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, southeast end of Enyu Island, outer reef., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 0.5
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141907
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, ocean reef, deep sandy pools, center of ocean reef at center of Bikini Island (directly out from seebee fence)., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141905
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, Romuk Island, lagoon side at east end of Romuk Island among slabs of coral beach rock., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 0.8
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141904
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, Bokonfusaku (Bokon) Island on ocean side., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141914
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz, V. Brock & R. Hiatt
Year Collected: 1947
Locality: Marshall Islands: Bikini Atoll: lagoon side reef halfway between Bikini and Amen Islands., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 3
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141913
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz, V. Brock, R. Hiatt & G. Myers
Year Collected: 1947
Locality: Marshall Islands: Bikini Atoll, Eman Island, western end next to channel reef with only moderate growth of corals and algae., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 3
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141912
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock & L. Schultz
Year Collected: 1947
Locality: Marshall Islands: Bikini Atoll, reef in lagoon about at end of sand spit west of Bikini Island., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141902
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, Romurikku (Romuk) Island, lagoon side along ledge, with some crevices, near shore., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141916
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Morrison & F. Cali
Year Collected: 1946
Locality: Marshall Islands: Eniwetok Atoll, Rujoru Island, Reef on ocean side., Eniwetok Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Epinephelus spilotoceps
Catalog Number: USNM 141921
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Kwajalein Atoll at lagoon reef located near southern end of Ennylabegan Island., Kwajalein Atoll, Ralik Chain, Marshall Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Epinephelus spilotoceps is a shallow water species (down to ~30 m depth) in insular coral reefs, where it occurs over lagoonal patch reefs, the upper slopes of channels, and reef margins (Heemstra and Randall 1993).

Fishery-independent
In the Maldives, where it was one of the more common species observed during underwater visual census, it occurs primarily on rubble patches, mainly near their edges and adjacent to areas of high coral relief rather than out in the open (Sluka and Reichenbach 1996). Almost nothing is known about its biology, though it grows to a maximum total length of ~35 cm.

Fishery-dependent
In Pohnpei, the species was captured primarily by spear on the outer reef, although there was little difference in the percentage of the species captured between out and inner reef locales (Rhodes and Tupper 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 30 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 43 samples.

Environmental ranges
  Depth range (m): 0.4575 - 47
  Temperature range (°C): 25.335 - 29.171
  Nitrate (umol/L): 0.043 - 2.714
  Salinity (PPS): 34.080 - 35.893
  Oxygen (ml/l): 4.336 - 4.757
  Phosphate (umol/l): 0.085 - 0.507
  Silicate (umol/l): 1.043 - 4.407

Graphical representation

Depth range (m): 0.4575 - 47

Temperature range (°C): 25.335 - 29.171

Nitrate (umol/L): 0.043 - 2.714

Salinity (PPS): 34.080 - 35.893

Oxygen (ml/l): 4.336 - 4.757

Phosphate (umol/l): 0.085 - 0.507

Silicate (umol/l): 1.043 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated. Occurs in lagoon patch reefs, the upper slopes of channels, and reef margins (Ref. 1602). Nothing has been published on its biology.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found inshore (Ref. 75154).
  • Nguyen, N.T. and V.Q. Nguyen 2006 Biodiversity and living resources of the coral reef fishes in Vietnam marine waters. Science and Technology Publishing House, Hanoi. (Ref. 58534)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epinephelus spilotoceps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACCGCCCTCAGCCTGCTTATTCGAGCTGAGCTGAGCCAGCCAGGAGCCCTACTTGGCGACGATCAAATCTATAACGTAATTGTTACAGCACACGCTTTTGTAATAATCTTCTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGACTTGTGCCACTTATAGTCGGCGCCCCAGATATGGCCTTCCCCCGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTGCTTCTCCTCGCCTCCTCCGGGGTAGAAGCTGGTGCTGGGACTGGCTGAACAGTCTACCCCCCTCTAGCCGGCAACCTAGCCCATGCAGGAGCATCTGTAGACTTGACCATCTTCTCACTTCACTTGGCAGGGGTTTCATCAATTCTGGGAGCAATTAACTTCATTACAACCATTATTAATATGAAACCCCCAGCCATCTCTCAGTATCAAACACCTTTATTCGTTTGAGCTGTACTAATTACAGCAGTTCTTCTGCTGCTCTCCCTCCCTGTGCTCGCCGCCGGTATTACTATACTTTTGACAGATCGCAACCTTAACACCACTTTCTTTGACCCGGCCGGAGGGGGAGACCCAATTCTCTACCAGCACTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus spilotoceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Pollard, D., Choat, J.H., Sadovy, Y., Craig, M. & Bertoncini, A.A.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Epinephelus spilotoceps is assessed as being of Least Concern primarily because of its very widespread distribution throughout the islands of the tropical Indo-West Pacific region, and the fact that it is a small species (max TL ~35 cm) and therefore probably not particularly sought after as a food fish. The exception here is in the Maldives live food fish trade, where it is one of the species taken, though not one of the top ten grouper species in this fishery. Elsewhere it is probably caught in local artisinal and subsistence fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
General
Epinephelus spilotoceps is apparently relatively common throughout most of its range. Its population trend unknown, but is probably relatively stable.

Fisheries-dependent data
Epinephelus spilotoeps represented 13.1% of the serranid catch by all combined gear types in Pohnpei in 2006 (Rhodes and Tupper 2007). It was the third most common grouper overall.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
General
Epinephelus spilotoceps does not appear to be threatened by overfishing, although the live food fish trade could pose a threat in the future, particularly if spawning aggregations are targeted.

Fishery-dependent
In the Maldives this species is captured in the live food fish trade, in which it is a common but not particularly important species. In this fishery it has a (nominal) annual export quota of 8000 individuals (Shakeel and Ahmed 1996, Sattar and Adam 2005). It is also listed as a "regulated species" in the Fisheries (Coral Reef Fin Fish) Management Plan 2003 of the Queensland Department of Primary Industries (Australia), though it is considered to be relatively insignificant in this primarily Great Barrier Reef line fishery (www2.dpi.qld.gov.au/fishguide). It is no doubt also caught in local artisinal and subsistence fisheries throughout most or all of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Epinephelus spilotoceps occurs in marine protected areas throughout its range, but there are no known measures specific to foursaddle grouper.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
  • Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Epinephelus spilotoceps

Epinephelus spilotoceps, commonly called foursaddle grouper among various other vernacular names, is a species of marine fish in the family Serranidae.[2]

Description[edit]

Epinephelus spilotoceps can reach a maximum length of 35 centimetres (14 in) in males.[3] The body is covered with dark brown, olive, or reddish brown polygonal spots, with the interspaces forming a white reticulum. Three dark brown blotches are usually visible at the base of the dorsal fin. Another dark brown blotch forms a saddle on the caudal peduncle. These blotches differentiates this species from the similar E. merra and E. quoyanus.[4]

Distribution[edit]

This grouper is widespread in Indo-West-Pacific, from East coast of Africa (Zanzibar, Tanzania to Ponta Zavora, Mozambique) to the islands of Indian and west-central Pacific but it is absent from the Red Sea, the Persian Gulf, the Sri Lanka, the Philippines, Taiwan and Japan.[5]

Habitat[edit]

Foursaddle grouper is a reef-associated species. It usually can be found in lagoons and reef margins at depths up to 30 metres (98 ft).[6]

References[edit]

  1. ^ Pollard, D., Choat, J.H., Sadovy, Y., Craig, M. & Bertoncini, A.A. 2008. Epinephelus spilotoceps. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 19 October 2013.
  2. ^ http://www.fishbase.org/comnames/CommonNamesList.php?ID=5837&GenusName=Epinephelus&SpeciesName=spilotoceps&StockCode=6134
  3. ^ FishBase
  4. ^ http://www.fishbase.org/summary/5837
  5. ^ http://www.fishbase.org/summary/5837
  6. ^ http://www.fishbase.org/summary/5837
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!