Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: scorpionfish (English), pez-escorpión (Espanol), rascacio (Espanol)
 
Taenianotus triacanthus Lacepède, 1802

Leaf scorpionfish

Head and body deep, highly compressed; no spines under eye; mouth oblique; one dorsal fin, its origin over rear edge of eye, fin high and sail-like, with XII spines, second 2-3 highest, almost no notch between spines and rays, 10-11 rays,  last ray attached to inner half of top of tail fin; scales in form of small, spiny papillae; pectorals a large fan; anal III, 6; tail fin rounded; lateral line continuous.

Variously mottled with tan, yellow, cream, red, brown, black.



Size: 10 cm.

Habitat: demersal, sand, rock, coral and algal bottoms.

Depth: 5-135 m.

Indo-Pacific; vagrant in the Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits reef flats, outer reef slopes, current-swept channels, and rarely on lagoon reefs (Ref. 1602). Benthic (Ref. 58302). Solitary and usually immobile among algae or seagrass but effects hip movements resembling that of a leaf falling down from a tree. Molts twice a month with the skin breaking off first in the head region. Has the habit of mimicking a dead leaf by swaying from side to side (Ref. 37816). Feeds on small crustaceans and fishes (Ref. 9710); also feeds on larvae (Ref. 5503). Venomous spines.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Depth

Depth Range (m): 5 (S) - 135 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa, Madagascar and western Mascarenes east to Galápagos Archipelago, north to southern Japan, Midway Atoll and Hawaiian Islands, south to Western Australia at 14°04'S, New South Wales (Australia), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Galapagos Islands, north to Ryukyu and Hawaiian islands, south to Australia and the Tuamoto Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 10.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 12; Dorsal soft rays (total): 8 - 11; Analspines: 3; Analsoft rays: 5 - 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 4313))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits reef flats, outer reef slopes, current-swept channels, and rarely on lagoon reefs. Solitary and usually immobile among algae or seagrass but effects hip movements ressembling that of a leaf falling down from a tree. Molts twice a month with the skin breaking off first in the head region. Feeds on small fish and larvae (Ref. 5503). Venomous spines.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tan to reddish or brown in color (Ref. 4313). Has prickly papillae instead of scales. Dorsal fin high, 3rd or 4th spine longest; suborbital ridge without spines or with lump at head of ridge; preopercle with 2 indistinct spines only; body extremely compressed; soft dorsal fin attached to the caudal fin; coloration is variable, from nearly all yellow to red, brown or nearly black and variously mottled with darker pigment (Ref. 10482).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Taenianotus citrinellus
Catalog Number: USNM 51634
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: South coast of Oahu Island, Honolulu Light, N. 2 degrees, E. 2.4 miles [nautical]., Oahu, Hawaii, United States, Hawaiian Archipelago, Pacific
Depth (m): 386
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Taenianotus citrinellus
Catalog Number: USNM 51634
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): United States Fish Commission (USFC)
Year Collected: 1902
Locality: South coast of Oahu Island, Honolulu Light, N. 2 degrees, E. 2.4 miles [nautical]., Oahu, Hawaii, United States, Hawaiian Archipelago, Pacific
Depth (m): 386
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 0.4575 - 109.8
  Temperature range (°C): 23.714 - 29.336
  Nitrate (umol/L): 0.026 - 0.221
  Salinity (PPS): 34.134 - 36.148
  Oxygen (ml/l): 4.454 - 4.891
  Phosphate (umol/l): 0.092 - 0.301
  Silicate (umol/l): 1.097 - 3.321

Graphical representation

Depth range (m): 0.4575 - 109.8

Temperature range (°C): 23.714 - 29.336

Nitrate (umol/L): 0.026 - 0.221

Salinity (PPS): 34.134 - 36.148

Oxygen (ml/l): 4.454 - 4.891

Phosphate (umol/l): 0.092 - 0.301

Silicate (umol/l): 1.097 - 3.321
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Macroalgae, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 5 - 135 m (Ref. 90102), usually 5 - 20 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 5 - 134m.
From 5 to 134 meters.

Habitat: reef-associated. Inhabits reef flats, outer reef slopes, current-swept channels, and rarely on lagoon reefs. Solitary and usually immobile among algae or seagrass but effects hip movements ressembling that of a leaf falling down from a tree. Moults twice a month with the skin breaking off first in the head region. Feeds on small crustaceans and fishes (Ref. 9710); also feeds on larvae (Ref. 5503). Venomous spines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 0.4575 - 109.8
  Temperature range (°C): 23.714 - 29.336
  Nitrate (umol/L): 0.026 - 0.221
  Salinity (PPS): 34.134 - 36.148
  Oxygen (ml/l): 4.454 - 4.891
  Phosphate (umol/l): 0.092 - 0.301
  Silicate (umol/l): 1.097 - 3.321

Graphical representation

Depth range (m): 0.4575 - 109.8

Temperature range (°C): 23.714 - 29.336

Nitrate (umol/L): 0.026 - 0.221

Salinity (PPS): 34.134 - 36.148

Oxygen (ml/l): 4.454 - 4.891

Phosphate (umol/l): 0.092 - 0.301

Silicate (umol/l): 1.097 - 3.321
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits reef flats, outer reef slopes, current-swept channels, and rarely on lagoon reefs. Molts twice a month with the skin breaking off first in the head region. Has the habit of mimicking a dead leaf by swaying from side to side (Ref. 37816). Feeds on small crustaceans and fishes (Ref. 3921, 9710); also on larvae (Ref. 5503).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taenianotus triacanthus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTGGTCTTTGGTGCCTGAGCAGGGATAGTAGGGACAGCCCTTAGTCTACTGATTCGGGCAGAATTAAGCCAACCCGGGGCTCTGCTGGGAGACGATCAGATTTATAATGTCATCGTCACAGCACATGCTTTCGTAATAATCTTTTTTATAGTAATACCAATTATGATCGGGGGTTTCGGTAATTGACTGATCCCACTGATGATCGGTGCCCCTGACATGGCATTCCCCCGTATAAACAACATGAGCTTCTGACTTCTCCCTCCGTCCTTTCTGCTCCTTTTAGCATCTTCTGGGGTAGAGGCCGGAGCCGGCACGGGTTGAACAGTTTACCCGCCTCTGGCGGGCAATTTAGCCCATGCAGGAGCATCAGTTGACCTTACCATTTTTTCCCTTCATTTAGCAGGCATCTCATCCATTTTGGGTGCAATTAACTTCATTACTACTATCATTAATATAAAACCTCCAACTATCTCGCAATACCAGACACCGCTATTCGTATGAGCAGTGCTAATTACTGCCGTACTCCTTCTTTTATCCCTCCCAGTGCTTGCCGCTGGCATCACAATACTTCTAACAGATCGTAACCTAAACACTACCTTCTTTGATCCGGCAGGCGGGGGAGACCCCATCCTTTACCAGCACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Taenianotus triacanthus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Leaf scorpionfish

The leaf scorpionfish or paperfish, Taenianotus triacanthus, is a species of marine fish, the sole member of its genus.

Description[edit]

The leaf scorpionfish is about 10 cm (4 in) long. Their color varies from green, red, pink, brown, ocher and yellowish to a ghostly white. The fish is almost as flat as a leaf and resembles a leaf in many other ways. The head and mouth are large. Through their eyes is a dark line. The large dorsal fin starts just behind the eyes and has 12 spines and eight to 11 soft rays.[1] The anal fin has three spines and five or six soft rays. The venom of the leaf scorpionfish is considerably weaker than that of the lionfish and stonefish. The skin often has blotches that enhance a camouflage effect. This fish has appendages around the mouth, and sometimes real algae and hydroids grow on its skin.

This fish molts every 10 to 14 days, and can change colors after the molt.[2]

Behavior[edit]

The leaf scorpionfish resembles a dead leaf lying in the water. To enhance this camouflage, it even makes gentle sideways movements in its pelvic area which make it resemble a drifting inert object.[1] It is an ambush predator, waiting until suitable prey, a small fish or shrimp, approaches. Then it slowly moves with its pectoral fins close to the victim. When the leaf scorpionfish is close enough, the prey is sucked in by a sudden opening of its mouth. It eats victims up to half its body length, but larger animals are completely ignored.

Distribution and habitat[edit]

Taenianotus triacanthus is widespread from east African coast and the Red Sea to the tropical Indo-Pacific, north to the Galapagos Islands, the Ryukyu Islands, Hawaii, and the coast of New South Wales. This species can be found in tropical waters on coral reefs, from shallow water to a depth of 130 m.

T. triacanthus in Vietnam
T. triacanthus in Bunaken, Sulawesi
Leaf scorpionfish in Borneo
Leaf scorpionfish on a sandy bottom

References[edit]

Template:Wikispeces

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!