Overview

Comprehensive Description

Biology

A rare inhabitant of mixed sand and rubble areas of reef flats and shallow lagoons. Feeds on fishes (Ref. 89972). Usually buries itself in the substrate when in sand or sits amongst rubble where it has good camouflage (Ref. 48635). Anterolateral glandular grooves with venom gland (Ref. 57406). Solitary or in pairs (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A rare inhabitant of mixed sand and rubble areas of reef flats and shallow lagoons. Usually buries itself in the substrate when in sand or sits amongst rubble where it has good camouflage (Ref. 48635). Anterolateral glandular grooves with venom gland (Ref. 57406). Solitary or in pairs (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: northwest Australia, Moluccas, and Philippines to the Marquesan and Society islands, north to Ryukyu Islands, south to Rowley Shoals, Western Australia, and Tonga; Mariana and Caroline Islands in Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Mauritius (Mascarenes); eastern Indonesia east to Tuamotu Archipelago and Marquesas Islands, north to Ryukyu Islands, south to Dampier Archipelago (Western Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 9; Analspines: 3; Analsoft rays: 5
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

13.6 cm TL (male/unsexed; (Ref. 90102))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 130 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Submarginal black band on inner pectoral fin surface complete; eyes relatively large; snout relatively short; hump on back less obvious as in S. diabolus; SL to 10.4 cm. No black spot nearly as large as eye on inner surface of pectoral fins. A narrow triangular black mark inside mouth at front of upper jaw behind teeth. Ascending process of premaxilla broad, its maximum width 1.4-1.8 in orbit diameter. No series papillae or nodules across interorbital space between supraocular spines. Nasal spine single (Ref 42181).Description: Characterized by having variable colors, depends on surrounding substrate; inner pectoral fin bright orange with small black spot at base and black submarginal band; double upper opercular spine; snout 3.1-3.4 in head length; depth of body 2.2-2.7 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Submarginal black band on inner pectoral fin surface complete; eyes relatively large; snout relatively short; hump on back less obvious as in S. diabolus; SL to 10.4 cm. No black spot nearly as large as eye on inner surface of pectoral fins. A narrow triangular black mark inside mouth at front of upper jaw behind teeth. Ascending process of premaxilla broad, its maximum width 1.4-1.8 in orbit diameter. No series papillae or nodules across interorbital space between supraocular spines. Nasal spine single (Ref 42181).Description: Characterized by having variable colors, depends on surrounding substrate; inner pectoral fin bright orange with small black spot at base and black submarginal band; double upper opercular spine; snout 3.1-3.4 in head length; depth of body 2.2-2.7 in SL (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0.4575 - 80.5
  Temperature range (°C): 25.161 - 29.003
  Nitrate (umol/L): 0.050 - 3.610
  Salinity (PPS): 34.179 - 36.148
  Oxygen (ml/l): 4.008 - 4.807
  Phosphate (umol/l): 0.086 - 0.392
  Silicate (umol/l): 1.027 - 4.097

Graphical representation

Depth range (m): 0.4575 - 80.5

Temperature range (°C): 25.161 - 29.003

Nitrate (umol/L): 0.050 - 3.610

Salinity (PPS): 34.179 - 36.148

Oxygen (ml/l): 4.008 - 4.807

Phosphate (umol/l): 0.086 - 0.392

Silicate (umol/l): 1.027 - 4.097
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 1 - 80 m (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0.4575 - 80.5
  Temperature range (°C): 25.161 - 29.003
  Nitrate (umol/L): 0.050 - 3.610
  Salinity (PPS): 34.179 - 36.148
  Oxygen (ml/l): 4.008 - 4.807
  Phosphate (umol/l): 0.086 - 0.392
  Silicate (umol/l): 1.027 - 4.097

Graphical representation

Depth range (m): 0.4575 - 80.5

Temperature range (°C): 25.161 - 29.003

Nitrate (umol/L): 0.050 - 3.610

Salinity (PPS): 34.179 - 36.148

Oxygen (ml/l): 4.008 - 4.807

Phosphate (umol/l): 0.086 - 0.392

Silicate (umol/l): 1.027 - 4.097
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters of the continental shelf. Often trawled (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scorpaenopsis macrochir

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTACCTCGTCTTTGGTGCCTGAGCCGGCATGGTTGGAACCGCCCTTAGCCTGCTTATTCGTGCAGAGTTAAGCCAACCCGGAGCCTTATTAGGTGACGACCAAATCTACAACGTAATCGTTACAGCACATGCTTTCGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTTGGCAACTGATTGATTCCATTAATGATTGGAGCCCCGGACATAGCATTCCCCCGAATGAATAATATGAGTTTCTGGCTTCTTCCCCCTTCCTTCCTTCTTTTGCTTGCCTCCTCAGGCGTTGAAGCAGGTGCCGGCACCGGTTGAACAGTTTACCCGCCCTTGGCTGGCAACTTAGCCCACGCCGGAGCATCGGTAGATTTGACTATCTTTTCACTACATTTAGCAGGGATTTCCTCAATTCTAGGGGCAATTAATTTTATCACTACTATTATTAATATAAAACCCCCAGCAGTCTCCCAATACCAAACCCCTCTATTCGTATGAGCAGTTCTTATTACAGCCGTACTTCTTCTCCTATCGCTTCCCGTTCTTGCTGCTGGTATTACCATGCTTTTAACGGACCGTAACCTAAATACAACCTTCTTTGACCCAGCAGGGGGTGGGGACCCCATCCTTTATCAGCATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scorpaenopsis macrochir

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Scorpaenopsis macrochir

The flasher scorpionfish or rough humpback scorpionfish, Scorpaenopsis macrochir, is a scorpionfish from the Pacific. It occasionally is found in the aquarium trade. It grows to a maximum of 13 cm (5 in) in length.

Description[edit]

The flasher scorpionfish has a broad, spiny head with a wide space between the eyes, a highly arched back, and a divided upper opercular spine. It has 12 spines in its dorsal fin and nine soft rays and the anal fin has three spines and five soft rays. The general color of this fish is brown mottled with white, and it can grow to a length of 13 cm (5 in). The large pectoral fin is flushed with yellow and orange on its inside and has a complete, broad black band near its margin and no large back spots. This fish is one of five very similar species of humpback scorpionfish and can be distinguished from S. diabolus, S. gibbosa, and S. obtusa by the markings on the inside of the pectoral fin. From S. neglecta it can also be differentiated by the presence of two to six points on the nasal spine.[1][2]

Distribution and habitat[edit]

It is indigenous to the tropical and subtropical waters of western and northwest Australia, the Moluccas, and the Philippines to the Marquesan and Society Islands, north to Ryukyu Islands, south to Rowley Shoals, Tonga, and the Mariana and Caroline Islands in Micronesia. S. macrochir is typically found on soft substrates, where it sometimes buries itself, camouflaged among rubble where it lies in wait for passing prey.

In aquaria[edit]

This fish occasionally is found in the aquarium trade, and is often confused with its larger relative Scorpaena diabolus (the devil scorpionfish). Like other Scorpaenifomes, it possesses venomous dorsal spines which deliver its venom. Although it is venomous, these spines are never used to attack other organisms, but are solely for defensive purposes. As its common name suggests, this fish possesses bright orange and yellow "flash colors" on the inner surfaces of its pectoral fins to ward off and confuse would-be attackers. These bright colors also serve as a warning that this fish is venomous.

See also[edit]

References[edit]

  1. ^ "Scorpaenopsis macrochir Ogilby, 1910: Flasher scorpionfish". FishBase. Retrieved 2013-12-20. 
  2. ^ Mark McGrouther (2013-02-28). "Humpback Scorpionfish, Scorpaenopsis macrochir Ogilby, 1910". Australian Museum. Retrieved 2013-12-20. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!