Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in sheltered bays and lagoon patch reefs from 5 to at least 20 m, forming small, loose aggregates in caves or just above branches of certain corals (Ref. 1602). Feeds on small fishes (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Tuamoto Islands, north to Ryukyu Islands, south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 187 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.7 cm SL (male/unsexed; (Ref. 1602))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in sheltered bays and lagoon patch reefs from 5 to at least 20 m, forming small, loose aggregates in mid-waters caves or just above branches of certain corals (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Juveniles have a small black spot surrounded by a large gold blotch on the caudal peduncle (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 20 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 1 - 19.5
  Temperature range (°C): 26.890 - 29.336
  Nitrate (umol/L): 0.043 - 0.622
  Salinity (PPS): 33.803 - 35.924
  Oxygen (ml/l): 4.413 - 4.641
  Phosphate (umol/l): 0.055 - 0.228
  Silicate (umol/l): 1.162 - 2.356

Graphical representation

Depth range (m): 1 - 19.5

Temperature range (°C): 26.890 - 29.336

Nitrate (umol/L): 0.043 - 0.622

Salinity (PPS): 33.803 - 35.924

Oxygen (ml/l): 4.413 - 4.641

Phosphate (umol/l): 0.055 - 0.228

Silicate (umol/l): 1.162 - 2.356
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 20m.
From 3 to 20 meters.

Habitat: reef-associated. Wolf cardinal. Attains 12 cm.  Occurs in sheltered bays and lagoon patch reefs from 5 to at least 20 m, forming small, loose aggregates in caves or just above branches of certain corals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in sheltered bays and lagoon patch reefs from 5 to at least 20 m, forming small, loose aggregates in caves or just above branches of certain corals (Ref. 1602). Feeds on small fishes (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cheilodipterus artus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cheilodipterus artus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTCGGTGCTTGGGCCGGAATAGTCGGAACAGCGCTCAGCCTGCTTATTCGAGCCGAGCTAAGTCAGCCGGGAGCCCTACTCGGCGATGACCAAATCTACAATGTAATTGTTACAGCACATGCATTTGTGATAATTTTCTTTATAGTAATGCCCATTATGATTGGGGGCTTTGGAAACTGATTAATCCCCCTAATGATTGGTGCCCCTGACATGGCCTTCCCCCGAATGAATAATATGAGCTTCTGACTTCTCCCCCCATCATTCCTCCTCCTGCTCGCCTCTTCTGGCGTAGAAGCTGGGGCCGGAACCGGATGGACCGTTTACCCCCCTCTTGCAGGCAACCTTGCCCACGCAGGGGCTTCCGTAGACCTAACAATCTTTTCCCTCCATCTAGCAGGTGTCTCGTCAATCCTTGGGGCAATTAACTTCATCACTACTATTATTAATATGAAACCCCCCGCGATCACTCAGTACCAGACCCCTTTATTCGTGTGGGCAGTCCTCATTACCGCCGTCCTCCTTCTCCTCTCCCTACCCGTCTTAGCCGCTGGTATTACAATGCTACTGACAGACCGAAATCTGAACACAACCTTCTTTGACCCAGCAGGAGGTGGTGACCCAATCCTGTACCAGCACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!