Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in sheltered bays and lagoon patch reefs from 5 to at least 20 m, forming small, loose aggregates in caves or just above branches of certain corals (Ref. 1602). Feeds on small fishes (Ref. 37816).
  • Gon, O. 1993 Revision of the cardinalfish genus Cheilodipterus (Perciformes: Apogonidae), with description of five new species. Indo-Pac. Fish. (22):59 p. (Ref. 8525)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Tuamoto Islands, north to Ryukyu Islands, south to the Great Barrier Reef.
  • Gon, O. 1993 Revision of the cardinalfish genus Cheilodipterus (Perciformes: Apogonidae), with description of five new species. Indo-Pac. Fish. (22):59 p. (Ref. 8525)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 8
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 187 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.7 cm SL (male/unsexed; (Ref. 1602))
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Juveniles have a small black spot surrounded by a large gold blotch on the caudal peduncle (Ref. 37816); characterized further by the following: mauve or pale grey color with eight reddish brown stripes; blackish to brown caudal fin base; adults capable of quick color change; greatest depth of body 3.2-4.0 in SL (Ref 90102).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Occurs in sheltered bays and lagoon patch reefs from 5 to at least 20 m, forming small, loose aggregates in mid-waters caves or just above branches of certain corals (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 25 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 1 - 19.5
  Temperature range (°C): 26.890 - 29.336
  Nitrate (umol/L): 0.043 - 0.622
  Salinity (PPS): 33.803 - 35.924
  Oxygen (ml/l): 4.413 - 4.641
  Phosphate (umol/l): 0.055 - 0.228
  Silicate (umol/l): 1.162 - 2.356

Graphical representation

Depth range (m): 1 - 19.5

Temperature range (°C): 26.890 - 29.336

Nitrate (umol/L): 0.043 - 0.622

Salinity (PPS): 33.803 - 35.924

Oxygen (ml/l): 4.413 - 4.641

Phosphate (umol/l): 0.055 - 0.228

Silicate (umol/l): 1.162 - 2.356
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 20m.
From 3 to 20 meters.

Habitat: reef-associated. Wolf cardinal. Attains 12 cm.  Occurs in sheltered bays and lagoon patch reefs from 5 to at least 20 m, forming small, loose aggregates in caves or just above branches of certain corals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in sheltered bays and lagoon patch reefs from 5 to at least 20 m, forming small, loose aggregates in caves or just above branches of certain corals (Ref. 1602). Feeds on small fishes (Ref. 37816).
  • Nguyen, N.T. and V.Q. Nguyen 2006 Biodiversity and living resources of the coral reef fishes in Vietnam marine waters. Science and Technology Publishing House, Hanoi. (Ref. 58534)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cheilodipterus artus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTCGGTGCTTGGGCCGGAATAGTCGGAACAGCGCTCAGCCTGCTTATTCGAGCCGAGCTAAGTCAGCCGGGAGCCCTACTCGGCGATGACCAAATCTACAATGTAATTGTTACAGCACATGCATTTGTGATAATTTTCTTTATAGTAATGCCCATTATGATTGGGGGCTTTGGAAACTGATTAATCCCCCTAATGATTGGTGCCCCTGACATGGCCTTCCCCCGAATGAATAATATGAGCTTCTGACTTCTCCCCCCATCATTCCTCCTCCTGCTCGCCTCTTCTGGCGTAGAAGCTGGGGCCGGAACCGGATGGACCGTTTACCCCCCTCTTGCAGGCAACCTTGCCCACGCAGGGGCTTCCGTAGACCTAACAATCTTTTCCCTCCATCTAGCAGGTGTCTCGTCAATCCTTGGGGCAATTAACTTCATCACTACTATTATTAATATGAAACCCCCCGCGATCACTCAGTACCAGACCCCTTTATTCGTGTGGGCAGTCCTCATTACCGCCGTCCTCCTTCTCCTCTCCCTACCCGTCTTAGCCGCTGGTATTACAATGCTACTGACAGACCGAAATCTGAACACAACCTTCTTTGACCCAGCAGGAGGTGGTGACCCAATCCTGTACCAGCACTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cheilodipterus artus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!