Overview

Comprehensive Description

Biology

Inhabits rocky, sandy and muddy bottoms as well as kelp beds (Ref. 4925). Adults and juveniles feed on crustaceans, fishes and mollusks (Ref. 6885). Commonly captured by sport fishers (from shore, boats or piers) and by scuba divers (Ref. 2850). Flesh is good eating but eggs are poisonous and will make humans violently ill (Ref. 13513).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Sitka, southeastern Alaska to Punta Abrejos, central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 12; Dorsal soft rays (total): 15 - 18; Analspines: 0; Analsoft rays: 11 - 13; Vertebrae: 35
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 990 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

99.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 14.0 kg (Ref. 27436); max. reported age: 13 years (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal fin barely rounded.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Scorpaenichthys marmoratus Girard
Catalog Number: USNM 314
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Heermann
Year Collected: 1853
Locality: San Francisco, Cal., California, United States, Pacific
  • Syntype: Girard, C. F. 1854. Proceedings of the Academy of Natural Sciences of Philadelphia. 7: 129.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 200 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.61 - 492
  Temperature range (°C): 6.140 - 6.140
  Nitrate (umol/L): 39.811 - 39.811
  Salinity (PPS): 34.301 - 34.301
  Oxygen (ml/l): 0.321 - 0.321
  Phosphate (umol/l): 3.216 - 3.216
  Silicate (umol/l): 81.249 - 81.249

Graphical representation

Depth range (m): 0.61 - 492
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 200m.
Recorded at 200 meters.

Habitat: demersal. Inhabits rocky, sandy and muddy bottoms as well as kelp beds (Ref. 4925). Adults and juveniles feed on crustaceans, fishes and molluscs; larvae prefer copepods and fish larvae (Ref. 6885). A female 65 cm in length may produce up to 95,000 eggs in a batch (Ref. 6885). Commonly captured by sport fishers (from shore, boats or piers) and by scuba divers. Flesh is good eating but eggs are poisonous and will make human violently ill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on fish, zoobenthos and zooplankton (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Scorpaenichthys marmoratus (cabezon) is prey of:
Ardeidae
Phalacrocoracidae
Gavia
Morone saxatilis
Melanitta
Homo sapiens

Based on studies in:
USA: California (Estuarine, Intertidal, Littoral)

This list may not be complete but is based on published studies.
  • G. E. MacGinitie, Ecological aspects of a California marine estuary, Am. Midland Nat. 16(5):629-765, from p. 652 (1935).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Scorpaenichthys marmoratus (cabezon) preys on:
Clevelandia
Cephalopoda
Octopus
Engraulis mordax

Based on studies in:
USA: California (Estuarine, Intertidal, Littoral)
USA: California, Southern California (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • G. E. MacGinitie, Ecological aspects of a California marine estuary, Am. Midland Nat. 16(5):629-765, from p. 652 (1935).
  • T. A. Clark, A. O. Flechsig, R. W. Grigg, Ecological studies during Project Sealab II, Science 157(3795):1381-1389, from p. 1384 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scorpaenichthys marmoratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTCCTAATTCGAGCTGAGCTGAGCCAACCCGGAGCCCTTTTAGGGGACGATCAAATTTATAATGTAATTGTTACAGCTCACGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATAATCGGGGGTTTCGGAAACTGACTCATTCCCCTAATGATCGGCGCTCCCGACATAGCGTTCCCTCGAATAAATAACATAAGTTTTTGACTTCTCCCTCCCTCCTTTCTTCTTCTCCTTGCCTCTTCAGGAGTAGAAGCCGGTGCCGGAACCGGGTGAACAGTTTATCCCCCTCTTGCTGGAAACCTGGCTCACGCAGGGGCTTCTGTTGATCTAACAATCTTCTCTCTACACCTAGCAGGGATTTCCTCAATTCTAGGAGCAATTAATTTCATCACAACCATCATCAACATGAAACCCCCTGCCATCTCTCAGTACCAAACCCCTCTTTTCGTGTGATCTGTTCTTATTACAGCCGTCTTACTACTTCTTTCCCTTCCAGTCCTTGCTGCCGGCATCACAATGCTTTTAACAGATCGTAACCTCAATACTACCTTTTTCGACCCAGCCGGAGGTGGAGATCCCATTCTCTATCAACACCTTTTCTGATTCTTCGC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scorpaenichthys marmoratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cabezon (fish)

For other meanings see cabezon (disambiguation).

The Cabezon, Scorpaenichthys marmoratus, is a sculpin native to the Pacific coast of North America. Although the genus name translates literally as "scorpion fish," true scorpionfish, i.e., the lionfish and stonefish, belong to the related family Scorpaenidae. This species is the only known member of its genus.[2]

Description[edit]

The cabezon is a scaleless fish with a broad bony support extending from the eye across the cheek just under the skin. Normally it has 11 spines on the dorsal fin. The cabezon also has a stout spine before the eye, an anal fin of soft rays, and a fleshy flap on the middle of the snout. A pair of longer flaps are just behind the eyes. The mouth is broad with many small teeth. The coloring varies, but is generally mottled with browns, greens and reds. >90% of red fish are males, whereas >90% of green fish are females. It reaches a weight of up to 25 pounds. As the Spanish-origin name implies, the fish has a very large head relative to its body.

Distribution and habitat[edit]

Cabezon are found from northern British Columbia to southern California.

They frequent kelp beds from shallow to moderate depths.

Fishing technique[edit]

Cabezon feed on crustaceans, mollusks, fish and fish eggs. Cabezon are taken as a game fish in California, however their roe is toxic to humans. Cabezon inhabit the tops of rocky ledges as opposed to rockfish and lingcod, which usually inhabit the sheer faces of these features.

The current world record for cabezone on hook and line is 23 pounds, 0 ounces in Juan de Fuca Strait, WA on Aug. 4, 1990 by Wesley Hunter.

References[edit]

  1. ^ "Scorpaeniformes". Paleobiology Database. Retrieved November 15, 2012. 
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2012). "Scorpaenichthys marmoratus" in FishBase. December 2012 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!