Overview

Comprehensive Description

Biology

Common in large rivers of the Sudan region (Ref. 7095).
  • Gosse, J.-P. 1990 Citharinidae. p. 261-268. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and O.R.S.T.O.M., Paris, 384 p. (Ref. 2938)   http://www.fishbase.org/references/FBRefSummary.php?id=2938&speccode=11264 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa: Senegal, Gambia, Niger, Volta, Ouémé and Chad basins and Lake Turkana. Two subspecies are recognized: Citharinus citharus citharus and Citharinus citharus intermedius.
  • Gosse, J.-P. 1990 Citharinidae. p. 261-268. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and O.R.S.T.O.M., Paris, 384 p. (Ref. 2938)   http://www.fishbase.org/references/FBRefSummary.php?id=2938&speccode=11264 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 17 - 21; Analsoft rays: 26 - 31
  • Gosse, J.-P. 1990 Citharinidae. p. 261-268. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and O.R.S.T.O.M., Paris, 384 p. (Ref. 2938)   http://www.fishbase.org/references/FBRefSummary.php?id=2938&speccode=11264 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

58.0 cm SL (male/unsexed; (Ref. 2938)); max. published weight: 7,000 g (Ref. 7095)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body depth 1.8-2.7x, head length 3.0-4.1 x SL. Caudal peduncle 0.7-1.4 x long than high. Short snout slightly prominent 0.7-1.6 x ocular diameter (3.7-6.1 x head length). Adipose base short 0.5-0.8 x its distance from dorsal fin. Pectoral 0.5-1.1 x head length. Silvery body, pectorals and superior lobe of caudal grayish, inferior lobe of caudal and anal red. Basal part of adipose black.
  • Gosse, J.-P. 1990 Citharinidae. p. 261-268. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and O.R.S.T.O.M., Paris, 384 p. (Ref. 2938)   http://www.fishbase.org/references/FBRefSummary.php?id=2938&speccode=11264 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; anadromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common in large rivers of the sudanian region (Ref. 7095). Feeds on phytoplankton, algae , macrophytes and organic debris (Ref. 6160).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Neoechinorhynchus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Total spawner (Ref. 56313).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Citharinus citharus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACATAGTATTTGGTGCCTGAGCTGGGATAATTGGTACAGCCCTGAGTCTATTAATTCGGGCGGAGCTCGGCCAACCCGGGTCCCTCCTAGAAGACGACCAAATCTATAATGTTCTCGTCACTGCACACGCCTTTGTAATAATCTTCTTTATAGTAATGCCAATCATGATTGGGGGGTTTGGAAATTGACTTATTCCTCTAATGATTGGCGCCCCCGACATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTTCTACCCCCTTCTTTCCTACTTCTCCTGGCCTCTTCAGGGGTTGAACAGGGGGCCGGAACAGGTTGAACTGTATATCCCCCCCTTGCCGGCAATCTTGCCCATGCGGGTGCCTCTGTTGACCTGACCATTTTCTCCCTTCACCTAGCCGGAGTCTCATCAATCTTAGGTGCAATTAACTTCATCACAACCATCATTAATATGAAACCGCCTGCTATTTCCCAGTATCAAACACCCCTATTTGTGTGAGCCATCCTAATTACAGCCGTCCTCCTTCTCCTATCCCTACCCGTTCTGGCCGCAGGTATTACCATGCTCCTAACCGATCGAAACCTAAATACCACTTTCTTTGACCCTGCAGGAGGAGGGGACCCAATTCTATACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Citharinus citharus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!