Overview

Comprehensive Description

Biology

Common in large rivers of the Sudan region (Ref. 7095).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Africa: Gambia, Senegal, Niger, Volta, Ouémé and Chad basins (Ref. 2938, 7095, 81281). Also known from Lake Turkana (Ref. 2938, 7095). Previously, 2 subspecies were recognized: Citharinus citharus citharus and Citharinus citharus intermedius.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 17 - 21; Analsoft rays: 26 - 31
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

58.0 cm SL (male/unsexed; (Ref. 2938)); max. published weight: 7,000 g (Ref. 7095)
  • Daget, J. 1984 Citharinidae. p. 212-216. In J. Daget, J.-P. Gosse and D.F.E. Thys van den Audenaerde (eds.) Check-list of the freshwater fishes of Africa (CLOFFA). ORSTOM, Paris and MRAC, Tervuren. Vol. 1. (Ref. 7095)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: body depth 1.8-2.7x and head length 3.0-4.1x SL; caudal peduncle 0.7-1.4x long than deep; short snout, slightly prominent; snout 0.7-1.6x eye diameter; eye diameter 3.7-6.1x head length; adipose-fin base shorter than distance separating it from rayed dorsal fin (ratio adipose base/distance to rayed dorsal is 0.5-0.8); pectoral fins 0.5-1.1x head length; cycloid scales; scale formula 22.5-25.5/77-92/22.5-25.5; 77-92 scales in longitudinal line; 17.5-20.5 scales between lateral line and pelvic fin; 17-21 dorsal fin branched rays; 26-30 anal fin branched rays (Ref. 2938, 81281). Description: eye protected by small adipose eyelid (Ref. 2938, 81281). Coloration: silvery body; pectorals fins and superior lobe of caudal greyish; inferior lobe of caudal fin and anal fin are red; basal part of adipose blackish (Ref. 2938, 81281).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; anadromous (Ref. 51243); freshwater
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common in large rivers of the sudanian region (Ref. 7095). Feeds on phytoplankton, algae , macrophytes and organic debris (Ref. 6160).
  • Daget, J. 1984 Citharinidae. p. 212-216. In J. Daget, J.-P. Gosse and D.F.E. Thys van den Audenaerde (eds.) Check-list of the freshwater fishes of Africa (CLOFFA). ORSTOM, Paris and MRAC, Tervuren. Vol. 1. (Ref. 7095)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Neoechinorhynchus Disease. Parasitic infestations (protozoa, worms, etc.)
  • Paperna, I. 1996 Parasites, infections and diseases of fishes in Africa. An update. CIFA Tech. Pap. No. 31. 220 p. FAO, Rome. (Ref. 45600)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Total spawner (Ref. 56313).
  • Olele, N.F. and A. Obi 2003 Reproductive biology of Citharinus citharus in Onah Lake, Asaba, Delta State of Nigeria. Trop. Freshwat. Biol. 12/13:119-129. (Ref. 56313)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Citharinus citharus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACATAGTATTTGGTGCCTGAGCTGGGATAATTGGTACAGCCCTGAGTCTATTAATTCGGGCGGAGCTCGGCCAACCCGGGTCCCTCCTAGAAGACGACCAAATCTATAATGTTCTCGTCACTGCACACGCCTTTGTAATAATCTTCTTTATAGTAATGCCAATCATGATTGGGGGGTTTGGAAATTGACTTATTCCTCTAATGATTGGCGCCCCCGACATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTTCTACCCCCTTCTTTCCTACTTCTCCTGGCCTCTTCAGGGGTTGAACAGGGGGCCGGAACAGGTTGAACTGTATATCCCCCCCTTGCCGGCAATCTTGCCCATGCGGGTGCCTCTGTTGACCTGACCATTTTCTCCCTTCACCTAGCCGGAGTCTCATCAATCTTAGGTGCAATTAACTTCATCACAACCATCATTAATATGAAACCGCCTGCTATTTCCCAGTATCAAACACCCCTATTTGTGTGAGCCATCCTAATTACAGCCGTCCTCCTTCTCCTATCCCTACCCGTTCTGGCCGCAGGTATTACCATGCTCCTAACCGATCGAAACCTAAATACCACTTTCTTTGACCCTGCAGGAGGAGGGGACCCAATTCTATACCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Citharinus citharus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!