Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in lagoon and seaward reefs to at least 40 m. Territorial around prominent coral formations called 'cleaning stations' (Ref. 9710). Juveniles generally solitary and quite secretive in caves while adults may wander over a large area in search of other fishes with ectoparasites (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the tropical and sub tropical waters (mainly between ~25° N and ~25° S) of the Indo-Pacific Region, from eastern Africa (Oman to South Africa) and the main Indian Ocean Islands in the west, to the Tuamotu Islands (French Polynesia) in the south Pacific Ocean in the east, and from southern Japan in the north west Pacific Ocean in the north, and via most of South East Asia to northern Western Australia, the southern Great Barrier Reef and Lord Howe Island in the south west Pacific Ocean in the south.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Line, Marquesan and Society islands, north to southern Japan, south to Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Natal (KwaZulu-Natal, South Africa) and East Africa, Madagascar and Mascarenes east to Wake Atoll and Pitcairn Group, north to southern Japan and Ogasawara Islands, south to Western Australia, Lord Howe Island, New Caledonia and Austral
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10 - 11; Analspines: 3; Analsoft rays: 9 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 140 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in lagoon and seaward reefs from 2 to at least 40 m. It feeds on ectoparasites (and mucus) of other fishes.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Labroides bicolor
Catalog Number: USNM 89970
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1908
Locality: Port Maricaban (Reef); China Sea, vicinity Southern Luzon, Maricaban Island, Batangas, Philippines, Philippine Archipelago, China Sea, Pacific
Depth (m): 4 to 6
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits coral rich areas from sub-tidal reef flats to deeper lagoons and seaward reefs, down to depths of at least 40 m (Lieske and Myers 1994, Letourner et al. 2004, Nguyen and Nguyen 2006).

Juveniles are generally solitary in deep ledges and are rarely seen cleaning. Adults tend to move over larger areas to clean, rather than waiting at fixed cleaning stations like some other cleaner wrasses (e.g. L. dimidiatus) (Kuiter 2002). It shows pronounced cleaning behaviour which only occurs during the day. Labroides bicolor is active in the daytime, and may possibly produce a protective mucous cocoon at night.

It is probably a monandric hermaphrodite, but might also undergo bi-directional sex-change (Robertson 1972, Kuwamura et al. 2002, Sadovy and Liu 2008, re L. dimidiatus). There appears to be no obvious adult colour dimorphism, the males and females having enerally the same colour pattern (though the male may exhibit a bluer head, Kuiter 2002). The juvenile colour pattern (yellow with a black stripe) is however different from that of the adults (Kuiter 2002).

It feeds on the crustacean ectoparasites of other fishes, probably including gnathiid isopods (Grutter 1997), and also on fish mucus (Masuda and Allen 1993).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 40 m (Ref. 37816), usually 2 - 20 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 1.83 - 59
  Temperature range (°C): 25.709 - 29.282
  Nitrate (umol/L): 0.050 - 0.822
  Salinity (PPS): 32.613 - 36.142
  Oxygen (ml/l): 4.130 - 4.806
  Phosphate (umol/l): 0.092 - 0.359
  Silicate (umol/l): 0.912 - 5.009

Graphical representation

Depth range (m): 1.83 - 59

Temperature range (°C): 25.709 - 29.282

Nitrate (umol/L): 0.050 - 0.822

Salinity (PPS): 32.613 - 36.142

Oxygen (ml/l): 4.130 - 4.806

Phosphate (umol/l): 0.092 - 0.359

Silicate (umol/l): 0.912 - 5.009
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 40m.
From 2 to 40 meters.

Habitat: reef-associated. Occurs in lagoon and seaward reefs to at least 40 m. Territorial around prominent coral formations called 'cleaning stations' (Ref. 9710). Juveniles generally solitary and quite secretive while adults may wander over a large area in search of other fishes with ectoparasites (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in lagoon and seaward reefs to at least 40 m. Territorial around prominent coral formations called 'cleaning stations' (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Labroides bicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCCTTTATTTAGTATTTGGTGCCTGAGCTGGCATGGTGGGGACAGCCTTGAGCCTACTCATTCGAGCTGAATTAAGCCAACCCGGCGCTCTCCTAGGAGATGATCAAATCTACAATGTAATCGTTACAGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGATATGGCTTTTCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCTTTCTTGCTTCTTCTTGCCTCCTCTGGTGTTGAAGCAGGGGCTGGAACTGGTTGAACAGTTTATCCTCCCTTAGCCGGAAACTTAGCTCACGCAGGAGCATCTGTTGACCTTACTATCTTTTCCCTTCACTTAGCCGGTATTTCATCCATTCTTGGGGCCATTAATTTCATTACAACCATTATTAATATAAAGCCCCCTGCTATTTCCCAGTATCAAACACCCCTCTTTGTTTGAGCCGTACTAATTACAGCTGTTCTTCTTCTACTATCCCTTCCCGTTCTGGCTGCTGGCATTACAATGCTTCTAACGGACCGTAATCTCAATACTACCTTCTTTGACCCTGCAGGAGGAGGAGACCCTATTTTATATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labroides bicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pollard, D., Yusuf, Y., Hilomen, V. & Pontillas, J.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is reasonably common throughout parts of its broad Indo-Pacific range. Although it is collected for the aquarium trade, it is not thought to be undergoing any widespread population decline. It is therefore listed as Least Concern. More research is needed on sustainable harvest levels and the impact of collection on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is relatively common in parts of its range. It is rare in many sites in the Philippines (Werner and Allen 2000, V. Hilomen pers. comm. 2008) and in peninsular Malaysia (Y. Yusuf pers. comm. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species. However, it used to be targeted in the marine aquarium fish trade but not commonly traded. Also, coral habitat degradation may have some localized impacts on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures for this species. However, its distribution includes numerous Marine Protected Areas within its range.

Given the collection of this species for the aquarium trade, more research is needed on the local and global impact of its collection, as well as on the implementation of sustainable harvest and trade measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!