Articles on this page are available in 3 other languages: Spanish (11), Dutch (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Grass carp originally came from East-Asia and can reach a length of 120 centimeters. The grass carp was first released in 1977 by water managers as a biological combatant for excessive aquatic plant growth. Since the fish can only spawn successfully when the water temperature rises to 25 degrees Celsius, in combination with a rapidly rising water level, the grass carp is probably unable to reproduce in the Netherlands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Adults occur in lakes, ponds, pools and backwaters of large rivers (Ref. 5723), preferring large, slow-flowing or standing water bodies with vegetation. Tolerant of a wide range of temperatures from 0° to 38°C, and salinities to as much as 10 ppt and oxygen levels down to 0.5 ppm. Feed on higher aquatic plants and submerged grasses; takes also detritus, insects and other invertebrates. One of the world's most important aquaculture species and also used for weed control in rivers, fish ponds and reservoirs (Ref. 9987). Spawn on riverbeds with very strong current (Ref. 30578). Utilized also fresh and eaten steamed, pan-fried, broiled and baked (Ref. 9987). Considered as a pest in most countries because of the damages made to submerged vegetation (Ref. 43281).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Asia: China to eastern Siberia (Amur River system, Ref. 1441). Widely transported around the world (Ref. 7248). Persists only in Europe by stocking (Ref. 59043). Introductions often brought with it the parasitic tapeworm Bothriocephalus opsarichthydis (synonym of B. acheilognathi) (Ref. 12217). Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: Native to Amur basin and flatland rivers of eastern Asia. Introduced in many localities in United States for control of aquatic vegetation. Widespread and increasing in lower and middle Mississippi Valley, spotty elsewhere. Natural reproduction has been recorded in the Mississippi, Missouri, Trinity (Texas), Red, and Washita (Oklahoma) rivers (Hargrave and Gido 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

China and Russia; widely introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 7 - 8; Analspines: 3; Analsoft rays: 7 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 125 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 1250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 30578)); max. published weight: 45.0 kg (Ref. 7248); max. reported age: 21 years (Ref. 48)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

No barbels. Snout very short, its length less than or equal to eye diameter. Postorbital length more than half head length (Ref. 4967). 18 soft rays for caudal fin (Ref. 40476). Diagnosed from rather similar species Mylopharyngodon piceus by having the following characters: body olive to brassy green above, silvery white to yellow below; body cylindrical; pharyngeal teeth laterally compressed, serrated, with a groove along grinding surface, usually in two rows, 2,5-4,2 (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Amur River Demersal Habitat

This taxon is one of a number of demersal species in the Amur River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

The largest native demersal fish species in the Amur River is the 560 centimeter (cm) long kaluga (Huso dauricus); demersal biota are those that inhabit the bottom of a surface water body. Another large demersal fish found in the Amur is the 300 cm Amur sturgeon (Acipenser schrenckii), a taxon which is endemic to the Amur basin.

Other demersal endemic fish species (all in the concubitae family) of the Amur Basin are Iksookimia longicorpa, I. koreensis, I. hugowolfeldi, Cobitis melanoleuca melanoleuca and the Puan spine loach (Iksookimia pumila).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat Type: Freshwater

Comments: Lakes, reservoirs, ponds, pools, and backwaters of large rivers. Tolerant of diverse conditions of temperature, oxygen level, and salinity. Eggs float until hatching.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater; depth range 0 - 30 m (Ref. 6898)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly vegetation. Young first feed on plankton, then switch to macrophytes. Adults seek fibrous plants. May also eat invertebrates and small fishes, especially in devegetated ponds. Intensive feeding occurs only when temeprature at least 20 C.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current velocities range from 0.6 m/s to 1.8 m/s. Feeding and spawning migrations depending on water temperature and water level are reported. The juveniles winter in deep holes in the river bed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Water mold Disease (l.). Fungal diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Water mold Disease (e.). Fungal diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unclassifed Grass Carp Virus. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tripartiella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodinosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infection 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infection 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infection 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodina Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

SVC. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sporozoa-infection (Myxobolus sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spiroxys Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sanguinicola Infection 1. Parasitic infestations (protozoa, worms, etc.)
  • Anderson, I.G. and F. Shaharom-Harrison 1986 Sanguinicola armata infection in bighead carp (Aristichthys nobilis) and grass carp (Ctenopharyngodon idella) imported in Malaysia. p. 247-250. In J.L. Maclean, L.B. Dizon and L.V. Hosillos (eds.) The first Asian Fisheries Forum. Asian Fisheries Society, Manila, Philippines. (Ref. 51771)   http://www.fishbase.org/references/FBRefSummary.php?id=51771&speccode=79 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Piscinoodinium Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myxobolus Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myxidium Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Grass Carp Picornavirus. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Grass Carp Haemorrhagic Disease Reovirus. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gonad Nematodosis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish louse Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Columnaris Disease (m.). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Columnaris Disease (l.). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Columnaris Disease (e.). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Capillaria Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bothriocephalus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anchorworm Disease (Lernaea sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anchor worm Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Strong schooling tendency. May cause increase in turbidity and alkalinity in waters where introduced; may compete with and prey upon native and exotic fishes (Sublette et al. 1990). In Arizona, biomass of largemouth bass increased in direct proportion to biomass of grass carp, perhaps because removal of vegetation by carp increased vulnerability of forage fishes to bass predation (see Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawns in gravel bottomed areas of rivers (Ref. 48). Eggs are pelagic and hatch while drifting downstream in 2-3 days (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 21 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

May spawn in spring and summer. Eggs hatch in 16-60 hours at 17-30 C. Sexually mature in 4-5 years in temperate areas. May live 15-20 years or more.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Ctenopharyngodon idella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Ctenopharyngodon idella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTACGCGCTGATTCTTTTCTACAAACCACAAAGACATTGGTACCCTCTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCTCTAAGCCTTCTCATTCGAGCCGAACTAAGCCAACCCGGATCACTTCTGGGCGATGATCAAATTTATAATGTTATTGTCACTGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTTATTGGAGGGTTTGGAAATTGACTCGTACCATTAATAATTGGAGCACCCGACATAGCATTCCCACGAATAAACAACATGAGTTTCTGACTTCTACCCCCTTCTTTCCTCCTACTATTAGCCTCTTCTGGTGTTGAGGCCGGAGCTGGAACAGGGTGAACAGTTTACCCACCACTCGCAGGCAATCTTGCCCACGCAGGAGCATCCGTAGACCTAACAATTTTCTCACTCCACCTGGCAGGTGTGTCATCAATTTTAGGGGCAATTAATTTTATTACTACAACCATTAACATGAAACCACCAGCCATCTCCCAATACCAAACACCTCTCTTCGTTTGAGCTGTACTTGTAACAGCTGTACTCCTTCTTCTATCTCTACCAGTTCTAGCCGCCGGAATTACAATACTCCTAACAGACCGTAATCTTAACACTACATTCTTTGACCCGGCGGGAGGAGGAGACCCAATTCTTTATCAACACTTATTCTGATTCTTTGGTCACCCGGAAGTTTATATTCTTATTTTACCCGGATTTGGAATCATTTCACATGTTGTAGCCTACTATGCAGGTAAAAAAGAACCATTCGGTTATATAGGAATAGTCTGAGCTATAATGGCTATTGGTCTTCTAGGGTTTATTGTATGAGCCCACCATATGTTTACTGTTGGGATAGACGTAGACACTCGTGCATATTTTACATCCGCAACGATAATTATTGCTATCCCAACAGGTGTAAAAGTATTTAGCTGACTAGCCACACTCCACGGAGGATCTATTAAATGAGAAACGCCCATGCTATGAGCTTTAGGATTTATTTTCCTTTTCACAGTGGGTGGATTAACAGGAATTGTCCTAGCCAATTCATCACTTGACATCGTCCTTCACGACACATATTATGTAGTCGCACACTTCCACTATGTACTATCAATAGGTGCCGTATTTGCCATTATGGCAGCCTTTGTTCACTGATTCCCTCTGTTTACAGGATATACTTTAAACGACACCTGAACAAAAATCCACTTTGGAGTAATGTTCATCGGTGTAAACCTCACATTCTTCCCGCAACACTTCCTAGGCCTAGCAGGAATGCCACGACGATACTCCGACTATCCGGACGCCTACGCCCTATGAAACACAGTATCATCTATCGGATCACTTATCTCCTTAGTAGCAGTAATTATATTCCTATTTATCCTATGAGAAGCCTTCGCCGCTAAACGAGAAGTTTCCTCAGTAGAACTAACTATGACAAACGCAGAATGACTTCATGGCTGCCCTCCACCATACCACACATTTGAGGAACCAGCATTTGTCCAAGTTCAATCAAACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Has been extensively stocked as effective biological control agent for aquatic plants; some states prohibit importation of this species, though several states have experimented with and allow stocking of functionally sterile triploids (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Triploid grass carp may degrade habitat for wildlife dependent upon aquatic vegetation; can eradicate submersed vegetation; difficult to attain intermediate levels of aquatic plant control (Bonar et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Grass carp

The grass carp (Ctenopharyngodon idella) is a herbivorous, freshwater fish species of the family Cyprinidae, and the only species of the genus Ctenopharyngodon. It is a large cyprind native to eastern Asia, with a native range from northern Vietnam to the Amur River on the Siberia-China border.[1] It is cultivated in China for food, but was introduced in Europe and the United States for aquatic weed control. It is a fish of large, turbid rivers and associated floodplain lakes, with a wide degree of temperature tolerance. Grass carp will enter reproductive condition and spawn at temperatures of 20 to 30°C (68 to 86°F).[1][2]

In the United States, the fish is also known as white amur, which is derived from the Amur River, where the species is probably native, but has never been abundant.[1] This is not to be confused with the white Amur bream (Parabramis pekinensis), which is not a particularly close relative.

For eating, the fish may be steamed, pan-fried, broiled, or baked.[3]

Appearance and anatomy[edit]

Grass carp
Grass carp

Grass carp have elongated, chubby, torpedo-shaped body forms. The terminal mouth is slightly oblique with non-fleshy, firm lips, and no barbels.[4] The complete lateral line contains 40 to 42 scales. Broad, ridged, pharyngeal teeth are arranged in a 2, 4-4, 2 formula. The dorsal fin has eight to 10 soft rays, and the anal fin is set closer to the tail than most cyprinids. Body color is dark olive, shading to brownish-yellow on the sides, with a white belly and large, slightly outlined scales.

The grass carp grows very rapidly. Young fish stocked in the spring at 20 cm (7.9 in) will reach over 45 cm (18 in) by fall. The average length is about 60–100 cm (24–39 in). The maximum length is 1.4 m (4.6 ft) and the maximum weight 40 kg (88 lb). According to one study, they live an average of five to 9 years, with the oldest surviving 11 years.[5] They eat up to three times their own body weight daily. They thrive in small lakes and backwaters that provide an abundant supply of freshwater vegetation.[citation needed]

Ecology[edit]

This species occurs in lakes, ponds, pools, and backwaters of large rivers, preferring large, slow-flowing or standing water bodies with vegetation.[4] In the wild, grass carp spawn in fast-moving rivers, and their eggs, which are slightly heavier than water, develop while drifting downstream, kept in suspension by turbulence. The eggs are thought to die if they sink to the bottom.[6]

Adults of the species feed primarily on aquatic plants. They feed on higher aquatic plants and submerged terrestrial vegetation, but may also take detritus, insects, and other invertebrates.[1][3]

Introduced species[edit]

Grass carp have been introduced to many countries around the world. In the Northern Hemisphere, countries of introduction include Taiwan, Japan, the Philippines, the USA, Mexico, India, Malaysia, the Netherlands, Switzerland, Czechoslovakia, Yugoslavia, Denmark, Sweden, Romania, Poland, Italy, West Germany, France, and the United Kingdom.[citation needed] In the Southern Hemisphere, they have been introduced to Argentina, Venezuela, Fiji, New Zealand, Australia, and South Africa. Grass carp are known to have spawned and established self-reproducing populations in only six of the many larger Northern Hemisphere rivers into which they have been stocked. Their failure to establish populations in other rivers suggests they have quite specific reproductive requirements.[7]

In the United States, the species was first imported in 1963 from Taiwan and Malaysia to aquaculture facilities in Alabama and Arkansas.[8] The first release is believed to have been an accidental escape in 1966 from the US Fish and Wildlife Service's Fish Farming Experimental Station in Stuttgart, Arkansas, followed by planned introductions beginning in 1969.[8][9] Subsequently there have been widespread authorized, illegal, and accidental introductions; by the 1970s the species had been introduced to 40 states, and it has since been reported in 45 of the country’s 50 states.[8][9] In 2013 it was determined to be reproducing in the Great Lakes Basin.[10] It is still stocked in many states as an effective biocontrol for undesirable aquatic vegetation,[8][9] many species of which are themselves introduced.

Grass carp require long rivers for the survival of the eggs and very young fish.

Use as weed control[edit]

The species was introduced in the Netherlands in 1973 for overabundant aquatic weed control. The release into national waters is controlled and regulated by the Dutch Ministry of Agriculture, Nature and Food Quality. Because grass carp mainly reproduce in water of 25°C (77°F), which is much higher than the water temperature reaches during the mating season in the Netherlands, grass carp populations must be maintained by artificial means, which is done by the person responsible for the water body in which the fish were introduced. Where grass carp populations are maintained through stocking as a biocontrol for noxious weeds, they should be returned to the water alive and unharmed.

Grass carp were also introduced into New Zealand in 1966 because of their potential to control the growth of aquatic plants. Unlike the other introduced fish brought to New Zealand, the potential value and impact of grass carp was investigated in secure facilities prior to their use in field trials.[11] They are approved by the New Zealand government as a biological control agent for aquatic weed control. Although the carp are unable to naturally reproduce, distribution is still carefully controlled by conservation agencies. The government has also embarked on using grass carp in aquatic weed eradication projects, such as Lakes Tutira, Opouahi, and Waikopiro for hydrilla and in Lakes Swan, Heather, Kereta for common hornwort (Ceratophyllum). Weed eradication has been achieved in Lake Elands and Lake Parkinson. These fish at times are often mistaken for koi carp (Cyprinus carpio) which are an unwanted organism and noxious species in the country.[12]

When used for weed control, often the fish introduced to the pond or stream are sterile, triploid fish. The process for producing triploid fish involves shocking eggs with a rapid change in temperature or pressure. This process is not usually 100% effective, so the young are usually tested for triploidy before being sold.[9]

Fishing for grass carp[edit]

A grass carp caught using white bread and six-pound test, monofilament line

Grass carp grow large and are strong fighters on a rod and reel, but because of their vegetarian habits and their wariness, they can be difficult to catch.[13] Chumming with corn adds to success. They will eat canned corn, cherry tomatoes, and, despite their primarily herbivorous habits, will also sometimes eat other animals. Chumming with white bread, and a piece of bread pinched on a hook and floated on the surface works well, especially for pond grass carp. The fish are popular among bowfishers where bowfishing for them is legal.

References[edit]

  1. ^ a b c d Mandrak and Cudmore. 2004. Biological Synopsis of Grass Carp (Ctenopharyngodon idella) http://sbisrvntweb.uqac.ca/archivage/24061712.pdf.
  2. ^ Shireman, J.V. and C.R. Smith. 1983. Synopsis of biological data on the grass carp, Ctenopharyngodon idella (Cuvier and Valenciennes, 1844). Food and Aquaculture Organization Synopsis. 135: 86pp.
  3. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2007). "Ctenopharyngodon idella" in FishBase. May 2007 version.
  4. ^ a b http://www.fishbase.org
  5. ^ Kirk and Socha. J. Aquat. Plant Manage. 41:2003. http://www.apms.org/japm/vol41/v41p90.pdf
  6. ^ Krykhtin, M.L., and E.I. Gorbach. 1981. Reproductive ecology of the grass carp, Ctenopharyngodon idella, and the silver carp, Hypophthalmichthys molitrix, in the Amur Basin. Journal of Ichthyology 21(2):109-123.
  7. ^ Rowe, D. K., & Schipper, C. M. (1985). An assessment of the impact of grass carp (Ctenopharyngodon idella) in New Zealand waters. Rotorua [N.Z.: Fisheries Research Division, Ministry of Agriculture and Fisheries.
  8. ^ a b c d Nico, L.G.; Fuller, P.L.; Schofield, P.J.; Neilson, M.E. (15 March 2012). "Grass Carp (Ctenopharyngodon idella)". Nonindigenous Aquatic Species (NAS) database. Gainesville, FL: United States Geological Survey. Retrieved 12 January 2014. 
  9. ^ a b c d Canover, G; Simmonds, R; and Whalen, M, ed. (November 2007). Management and Control Plan for Bighead, Black, Grass, and Silver Carps in the United States (PDF). Washington, DC: Asian Carp Working Group, Aquatic Nuisance Species Task Force. pp. 21–27. 
  10. ^ Chapman, Duane C.; Davis, Jeremiah J.; Jenkins, Jill A.; Kocovsky, Patrick M.; Miner, Jeffrey G.; Farver, John; Jackson, P. Ryan (2013). "First evidence of grass carp recruitment in the Great Lakes Basin". Journal of Great Lakes Research 39 (4): 547–554. doi:10.1016/j.jglr.2013.09.019. ISSN 0380-1330. 
  11. ^ http://www.niwa.co.nz/freshwater-and-estuaries/nzffd/NIWA-fish-atlas/fish-species/grass_carp
  12. ^ http://www.doc.govt.nz/conservation/threats-and-impacts/animal-pests/animal-pests-a-z/fish/facts/koi-carp/
  13. ^ Catching Grass Carp, Missouri Department of Conservation http://mdc4.mdc.mo.gov/Documents/18513.pdf
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!