Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

Very little is known about this shark's social and mating behaviour, but they are thought to be solitary, coming together only to mate. Males are believed to nip a female's fins to entice her into mating (2). Reproduction in this shark is ovoviviparous; the young hatch from eggs retained within the mother so that she then gives birth to live young (2) (3). The exact gestation period is unknown, but it is thought to be longer than two years. Each litter can number from 22 to 108 pups and this incredibly large litter size suggests that juvenile mortality rates are high (2). Age determination is difficult in this species but males are believed to mature at 11 to 14 years, females at 18 to 35 years, and longevity to reach 80 years for both sexes (3). The bluntnose six-gill shark is a skilled predator and may also scavenge, feeding nocturnally on a wide variety of marine organisms including other sharks, rays, bony fishes, squid, crabs, and seals (1) (2). Although reported as being sluggish in nature, they can reach remarkable speeds when chasing prey (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

As its common name alludes, the bluntnose six-gill shark has a characteristically blunt rounded snout and six long gill slits on either side of its head, instead of the five that are usual amongst sharks (2). Other distinguishing features include its fluorescent green eyes, six saw-like teeth on each side of the lower jaw and the singular dorsal fin located close to the caudal fin (3). Colouring ranges from greyish-black to chocolate brown on the back, lightening to a greyish white underside, with a distinctive light stripe along the sides and white edging on the fins (4). Females tend to be slightly larger than males (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Hexanchus griseus (Bonnaterre, 1788)

Sea of Marmara : 300-2 (1 spc.), 30.07.1991 , Offshore of Guezelce , 334 m , N. Meriç .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 31-31, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: shark (English), tiburón (Espanol), cañabota (Espanol)
 
Hexanchus griseus (Bonnaterre, 1788)

Bluntnose sixgill shark

Large, heavy bodied; head and snout wide, rounded; eyes relatively small; mouth narrow, strongly arched;  upper teeth small, narrow, with 1 large oblique point at front, progressively wider and more comblike on sides; lower teeth comb-like (long, low, serrated, oblique cutting edge), in 6 rows; six large gill slits, none over pectoral base; 1 dorsal fin, at rear of body, close to tail fin (separated from tail fin base by a distance ~equal to the length of its base); tail strongly asymmetrical, with much small lower lobe.

Grey to black above, paler to white below; lateral line pale; rear edges of fins pale.

Size: 482 cm.

Habitat: bottom and mid-water.

Depth: 0-3000 m, usually 500-1600 m.

A warm to cold temperate, circumglobal species that enters the northern and southern fringes of our region (southern Baja California and southern Colombia to Peru).
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Depth range reported at 0m-2000m. A deepwater species of the outer continental and insular shelves and upper slopes (Ref. 6871). Near bottom, occasionally pelagic, adults usually below 91 m (Ref. 58302). Juveniles may be found close inshore (Ref. 6871). Found on the bottom by day, moving to the surface at night to feed, and where it may take longlines set for other species (Ref. 45445). Depth distribution related to growth and temperature, with juveniles having most shallow records and from colder, poleward regions (Ref. 58302). Feeds on a wide range of marine organisms, including other sharks, rays, chimaeras, bony fish, squids, crabs, shrimps, carrion, and even seals. Ovoviviparous (Ref. 205), with 22 to 108 pups in a litter (Ref. 247). Marketed fresh, frozen, or dried salted; also utilized as a source of oil and fishmeal. Not known to have attacked people without provocation (Ref. 247). Give birth to almost 100 young (Ref. 35388).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Hexanchus griseus occur globally in all oceans. These sharks live and thrive in the most widespread distribution of all known sharks, with the possible exception of white sharks.

Biogeographic Regions: indian ocean; atlantic ocean ; pacific ocean ; mediterranean sea

Other Geographic Terms: cosmopolitan

  • MacQuity, M., D. King. 2000. SHARKS. New York: DK Publishing, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Circumglobal in tropical and temperate seas (including Mediterranean Sea, Baltic Sea, North Sea, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

This species is widely but disjunctly distributed in temperate and tropical seas of the continental and insular shelves of the Pacific, Atlantic (including the type locality in the Mediterranean Sea) and Indian Oceans. It occurs from the surface to at least 2,000 m, on continental and insular shelves and upper slopes (including sea mounts).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nova Scotia, in Emerald Basin, to Northern Argentina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California + Peruvian provinces, primarily, Continent + Island (s), Continent

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province ), Antitropical (North and South temperate)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal: In tropical and temperate waters; (Ref. 13573). Western Atlantic: North Carolina to Florida (USA) and northern Gulf of Mexico to northern Argentina. Eastern Atlantic: Iceland and Norway to Namibia, including the Mediterranean. Indian Ocean: Madagascar, Mozambique, South Africa, and Arabian Sea (Ref.85183). Western Pacific: eastern Japan to New Zealand and Hawaii. Eastern Pacific: Aleutian Islands, Alaska to Baja California, Mexico; also Chile . Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139, Ref. 41819).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The bluntnose six-gill shark is one of the wider ranging sharks, occupying temperate and tropical seas around the world (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 3000 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Hexanchus griseus is characteristically a large shark species with a heavy build. These sharks have a short, blunt snout, a broadly rounded mouth, and six pairs of gill slits (from which its common name, the bluntnose sixgill, is derived). They have large, green eyes and broad comb-like teeth on each side of the lower jaw arranged in 6 rows. Their coloring shades varies from grayish-black to chocolate brown on the dorsal surface and lightens to grayish-white on its belly. There is an anal fin, and one dorsal fin located on the back end of the body. The caudal fin is slightly raised so that the lower lobe is lined up with the body axis. The pelvic fins are located to the anterior of the anal fin and are a bit larger. Like many benthic sharks, the caudal fin of Hexanchus griseus has a weakly developed lower lobe. However, the bluntnose sixgill shark is still a very strong swimmer.

There exist size differences between male and female sharks. Females tend to be slightly larger than males, averaging around 4.3 m in length while males tend to stay near 3.4 m. There is little or no color difference between the sexes; however, the seasonal scars appearing on the fins of females, which are believed to be a result of mating, are commonly used for sex identification. Sex can be easily determined by the presence of elongate claspers on the pelvic fins of male sharks. The bluntnose sixgilled shark is classified under the genus Hexanchus with only one other species, Hexanchus nakamurai, or the bigeyed sixgill shark. Both sharks are similar in all aspects aside from their unmistakable size difference. While H. nakamurai reaches only about 2.3 m in length, H. griseus reaches lengths of 4.8 m.

Range mass: 480 to 720 kg.

Average mass: 500 kg.

Range length: 3.5 to 4.8 m.

Average length: 3.7 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Parker, S., J. Parker. 2002. The Encyclopedia of Sharks. Ontario: Firefly Books LTD.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
  • Last, P.R. and J.D. Stevens 1994 Sharks and rays of Australia. CSIRO, Australia. 513 p. (Ref. 6871)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 482.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 8500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

482 cm TL (male/unsexed; (Ref. 247)); max. published weight: 590.0 kg (Ref. 27436)
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
  • Lamb, A. and P. Edgell 1986 Coastal fishes of the Pacific northwest. Harbour Publishing Co. Ltd., B.C., Canada. 224 p. (Ref. 27436)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Sits on the bottom by day, and rise to the surface at night to feed. Feeds on a wide range of marine organisms, including other sharks (conspecifics) rays, chimaeras, bony fishes including dolphinfishes, swordfish & marlin, herring, grenadiers, cod, ling, hake, flounders, gurnards & anglers, as well as squids, crabs, shrimps, carrion and even seals. Ovoviviparous with 22-108 in a litter. Not known to have attacked people without provocation. Sensitive to low light. Used for food either fresh, frozen, or dried salted. Also utilized for fishmeal and oil.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A heavily-bodied, broad-headed sixgill shark, mouth ventral with 6 rows of lower, bladelike, comb-shaped teeth on each side (Ref. 247). Snout broadly rounded, body fusiform (Ref. 6871). Anal fin smaller than dorsal fin (Ref. 6871). Brown or grey above, paler below, with a light stripe along side (Ref. 26346). Fins with white edges (Ref. 6574). Live specimens with fluorescent green eyes (Ref. 6871). Six gill slits are very long (Ref. 35388).
  • Last, P.R. and J.D. Stevens 1994 Sharks and rays of Australia. CSIRO, Australia. 513 p. (Ref. 6871)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Hexanchus griseus
Catalog Number: USNM 27369
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Neah Bay, W.T., Clallam County, Washington, United States, North America
  • Type: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (23): 352.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Hexanchus griseus is mainly a deep water shark, rarely found at depths of less than 100 m. The species seems to usually stay close to the bottom, near rocky reefs or soft sediments. The deepest one has been found was about 2500 m.

These sharks are diel vertical migrators; they are nocturnal and remain in the deep oceans during the day but rise towards the surface at night. Hexanchus griseus also seasonally migrates to shallower coastal waters. During the warmer months of the year, these sharks can occasionally be found in shallower waters at depths of 23 to 39 m during the day and as shallow as 3 m at night.

Range depth: 3 to 2,500 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
A capable predator, the Bluntnose Sixgill Shark feeds on a wide variety of animals including other sharks (it is known to attack hooked conspecifics, which it sometimes follows to the surface from depth), skates, rays, chimaeras, dolphinfish, small swordfish and marlins, herring, grenadiers, antimoras (codlings), rockfishes, cod, lingcod, hake, flounders, halibut, turbot, gurnards and anglerfish, as well as many types of invertebrates including squid, crabs, sea cucumbers and shrimp. It also eats carrion and sometimes seals (Ebert 1994). The bluntnose sixgill shark has not been involved in shark bite incidents on humans, but has been known to swim up to and examine divers (off southern Vancouver Island, British Columbia, Canada) and rarely surfers (Cannon Beach, Oregon, USA) without threat or physical contact (C. Bond pers. comm. 1985). Small specimens thrash and snap when captured, but large individuals offer little resistance. This shark appears to become increasingly sensitive to light with increasing size. Adults may become highly agitated when exposed to even moderately intense light. However, this phenomenon needs much more investigation, since the species has been observed and/or photographed from research submersibles off Bermuda and California in well-lighted situations (floodlights) without undue agitation or avoidance of lighted areas (B. Lea pers. comm.).

The species is ovoviviparous, bearing very large litters numbering from 22-108 young, size at birth 65-74 cm. Males mature at about 315 cm and females at about 420 cm. Longevity, pupping interval and mating behaviour are unknown. Pupping grounds apparently occur on the upper slopes and outer continental shelves. Since this species preys on conspecifics opportunistically, some mechanism of separation of larger and smaller individuals undoubtedly occurs (Ebert 1994). Young tend to be found in shallow waters often just off the shore, but as they grow they move into successively deeper waters. Adults tend to follow diurnal patterns of vertical distribution, sitting deep on the bottom by day and coming toward or to the surface at night to feed. As for many species of deep-water sharks, it is unknown whether this species segregates by sex.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; oceanodromous (Ref. 51243); marine; depth range 1 - 2500 m (Ref. 58302), usually 180 - 1100 m (Ref. 45445)
  • Castro, J.I., C.M. Woodley and R.L. Brudek 1999 A preliminary evaluation of the status of shark species. FAO Fish. Tech. P. 380, Rome, FAO, 72 p. (Ref. 45445)
  • Mundy, B.C. 2005 Checklist of the fishes of the Hawaiian Archipelago. Bishop Museum Bulletins in Zoology. Bishop Mus. Bull. Zool. (6):1-704. (Ref. 58302)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 77 specimens in 1 taxon.
Water temperature and chemistry ranges based on 53 samples.

Environmental ranges
  Depth range (m): 39 - 959.5
  Temperature range (°C): 6.344 - 20.477
  Nitrate (umol/L): 8.721 - 35.221
  Salinity (PPS): 33.799 - 36.379
  Oxygen (ml/l): 0.860 - 5.925
  Phosphate (umol/l): 0.442 - 2.571
  Silicate (umol/l): 1.882 - 43.395

Graphical representation

Depth range (m): 39 - 959.5

Temperature range (°C): 6.344 - 20.477

Nitrate (umol/L): 8.721 - 35.221

Salinity (PPS): 33.799 - 36.379

Oxygen (ml/l): 0.860 - 5.925

Phosphate (umol/l): 0.442 - 2.571

Silicate (umol/l): 1.882 - 43.395
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 2000m.
Recorded at 2000 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A reclusive deepwater species, found in the waters of continental and insular shelves and upper slopes (4). Juveniles may be found closer inshore while adults occupy deeper waters (1). This shark rests along the bottom during the day to depths of 2,000 meters, swimming close to the surface at night to feed (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Rocks, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel, Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Hexanchus griseus is a skilled predator and is solely carnivorous, feeding on such animals as fishes, rays, and other sharks. Although they have been reported as being sluggish in nature, their body structure enables them to reach remarkable speeds for chasing and effectively capturing prey. Aside from feeding on molluscs and marine mammals, they eat crustaceans (crabs and shrimp), agnathans (Hagfish and sea lampreys), chondrichthyans (ratfish) and teleosts (dolphinfish and lingcod). A subspecies of H. griseus living in Cuban waters is also a skilled scavenger that feeds on carcasses of mammals.

Animal Foods: mammals; fish; carrion ; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range reported at 0m-2000m. A deepwater species of the outer continental and insular shelves and upper slopes (Ref. 6871, 75154). Near bottom, occasionally pelagic, adults usually below 91 m (Ref. 58302). Juveniles may be found close inshore (Ref. 6871). Found on the bottom by day, moving to the surface at night to feed, and where it may take longlines set for other species (Ref. 45445). Depth distribution related to growth and temperature, with juveniles having most shallow records and from colder, poleward regions (Ref. 58302). Feeds on a wide range of marine organisms, including other sharks, rays, chimaeras, bony fish, squids, crabs, shrimps, carrion, and even seals. Is a eurytrophic predator that is capable of exploiting a wide range of prey species and habitats (Ref. 26969). A vertical migrant, it may sit on the bottom by day, and rise to the surface at night to feed (Ref. 247).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes, sharks/rays, sea snakes/mammals/turtles/birds
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

This species is a large, deep-water predator, but we have little information on its ecological effects. There is some evidence that Hexanchus griseus has an important impact on the white sharks' population off the coast of South Africa. Researchers there believe that H. griseus will eventually outcompete Carcharodon carcharias in that area. H. griseus is not known to participate in any symbiotic relationships.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hexanchus griseus has no known evolved anti-predator adaptations. These sharks, however, are equipped with very sensitive perception organs, which may allow them to detect potential predators. The retinas are comprised of mostly rods and, therefore, do not function well in even moderately lit areas but are well suited for the dark conditions of the deep oceans. Being such a large-bodied shark, its only real predators would be other big sharks, such as whites, or possibly orca whales, which are known to prey on adult sharks. Young H. griseus have been taken by sharks, whales, dolphins, and sea lions.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Hexanchus griseus are believed to have few forms of communication, as they seem to be solitary animals for the most part. Yet any social forms of communication that do exist between these animals are unknown. The only known form of communication to occur in H. griseus is during mating. The males are believed to use their teeth to entice the females into mating. These sharks are equipped with highly sensitive scent and visual organs, which are useful for perceiving the dark environment they live in. H. griseus is also able to detect other organisms by means of its lateral line system (used for detecting vibrations), and its ampullae of Lorenzini (which detect faint electric signals).

Communication Channels: visual ; tactile

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Little is yet known about the life cycle and fetal development of Hexanchus griseus.

  • Ebert, D. 2002. Some observations on the reproductive biology of the Sixgill Shark Hexanchus griseus . South African Journal of Marine Science, 24: 359-363.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ovoviviparous, litters very large, 22 to 108 (Ref. 247). Size at birth 60-75 cm (Ref. 26346). Distinct pairing with embrace (Ref. 205).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 1 - Hexanchiformes to Lamniformes. FAO Fish. Synop. 125(4/1):1-249. Rome: FAO. (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is little information available about the lifespan of Hexanchus griseus. These sharks have a life expectancy no longer than 80 years in the wild. There is some suggestion that because they have such high infant birth rates, mortality rates could be very high as well. There is no known record for the oldest bluntnose sixgill shark in the wild, and this species has not been excessively studied or maintained in captivity, so there is no information on its lifespan in captivity. A new study is available, however, regarding the age determination of H. griseus. Previous techniques used in determining the age of H. griseus have been unsuccessful because of its poorly calcified vertebral centra (a characteristic of deep-water species and of primative families). This new study indicates that examining the neural arches on the fins of H. griseus can be useful in determining the age of this particular shark.

Average lifespan

Status: wild:
about 80 years.

  • McFarlane , G., J. King, M. Saunders . 2002. Preliminary study on the use of neural arches in the age determination of bluntnose sixgill sharks. Fish Bulletin, 4: 861-864.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Very little is known about these sharks in terms of their social behavior and thus little is known about their mating systems. There are a few theories, however, attempting to explain how H. griseus mates. Researchers believe that the morphology of the teeth of H. griseus play an important role in mating. The male has a more erect primary cusp than do the females. The male is believed to nip the female's gills with this cusp in order to catch her attention and entice her into mating. Evidence supporting this idea of courtship is evident by the seasonal scars that appear on females every year presumably from being nipped by males. Bluntnose sixgill sharks are believed to be primarily solitary animals and there is no information indicating whether they prefer one or many mates.

There is not much information pertaining to the reproductive behavior of Hexanchus griseus; however, there is some hypothetical information available. These sharks are believed to meet seasonally, moving to shallower depths in the May to November months. Scientists are unsure of the bluntnose sixgill shark's gestation period, but it is thought to be longer than 2 years. The means of reproduction for these sharks is ovoviviparity, meaning they carry their eggs internally until they hatch. Babies develop within the mother without a placenta to provide nourishment, and they are born at a fairly mature size (generally 70 cm at birth). Each litter can number from about 22 to 108 pups and this incredibly large litter size for H. griseus could suggest that mortality rates for the pups are very high. Little is known about their maturation because until recently determining their age was difficult as a result of their poorly calcified vertebrae. The pups of H. griseus, however, are speculated to mature around 11 to 14 years for males and 18 to 35 years for females. Little else is known about its reproductive system.

Breeding season: May - November.

Range number of offspring: 22 to 108.

Range age at sexual or reproductive maturity (female): 18 to 35 years.

Range age at sexual or reproductive maturity (male): 11 to 14 years.

Key Reproductive Features: seasonal breeding ; sexual ; fertilization (Internal ); ovoviviparous

There is no information available pertaining to parental care for Hexanchus griseus. However, as with other sharks, it can be assumed that no parental care is given to the young, which can number up to 108.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • MacQuity, M., D. King. 2000. SHARKS. New York: DK Publishing, Inc.
  • Martin, R. 2000. "Biology of the Bluntnose Sixgill" (On-line). Accessed July 28, 2004 at http://elasmo-research.org/research/sixgill.htm.
  • Musick, J. A., B. McMillan. 2002. The Shark Chronicles. New York: Henry Holt and Company, Inc.
  • Parker, S., J. Parker. 2002. The Encyclopedia of Sharks. Ontario: Firefly Books LTD.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hexanchus griseus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAATTTTTGGTGCCTGAGCAGGAATAGTGGGTACAGCCCTGAGTCTACTTATTCGAACAGAATTAAGTCAACCCGGAACACTTTTAGGAGATGATCAGATTTACAATGTAATTGTTACTGCCCACGCTTTCGTAATAATCTTCTTCATAGTAATACCCGTAATAATTGGTGGGTTCGGAAATTGACTAGTACCCTTAATGATCGGTGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGCTTCTGATTATTACCCCCTTCTTTCTTACTCCTTTTAGCCTCAGCTGGTGTAGAGGCAGGTGCCGGCACCGGTTGAACAGTCTATCCACCACTTGCAGGTAATCTAGCTCACGCAGGGGCATCCGTAGACCTAACTATTTTTTCATTACATCTAGCTGGTATTTCCTCAATTCTAGCATCAATTAATTTCATTACCACTATTATTAATATGAAACCCCCAGCTATTTCCCAATACCAAACCCCTCTTTTTGTTTGATCAATTTTTGTCACTACTATTCTTCTCCTCCTTTCCCTCCCTGTCCTTGCAGCTGGAATTACTATACTATTAACTGATCGTAATTTAAATACAACATTCTTTGACCCTTCAGGGGGAGGAGATCCTATTCTCTATCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hexanchus griseus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Fishermen are killing H. griseus for sport and for food (as they are being more frequently spotted in fishing areas) faster than ever before. Because of their low reproductive rate, sixgill sharks can easily be over-harvested. There are new regulations being enacted prohibiting the recreational killing of these sharks. The IUCN rates this species as "Lower Risk/Near Threatened", and notes that the lack of population data means that this species could be in more trouble than we know.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2005

Assessor/s
Cook, S.F. & Compagno, L. J.V.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Bluntnose Sixgill Shark (Hexanchus griseus) is wide ranging, although patchily distributed, in boreal, temperate and tropical seas. It is a deep-benthic, littoral and semipelagic shark, not known to be epipelagic. Young are often found close inshore, adults often in deeper water, although adults and sub¬adults are known to enter shallow water in bays with adjacent deepwater canyons. In tropical areas it tends not to penetrate coastal waters. Largely caught as a bycatch of other fisheries, this is also a valuable food and sports fish that appears very vulnerable to overfishing, unable to sustain intensive, targeted fisheries for long periods. Some regional populations have been severely depleted, e.g. in the Northeast Pacific. However, population and fisheries data are lacking from many regions.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Lower Risk/near threatened (LR/nt) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Due to its broad depth range and relative sluggishness, this shark has often been captured incidentally in fisheries for other species. It is taken by handline, longline, gillnet, traps, trammel net, and both pelagic and bottom-trawls. When captured it is often smoked in the Pacific Northwest U.S. (Washington State) and Italy to produce a fine cured product, usually for export to European markets. It is occasionally used for meat and liver oil in Australia (Last and Stevens 1994). Additionally, it has been used for salted and dried food products, as well as fish meal and pet foods. Uses of fins may exist but are unreported. This species has been sought for sport fisheries in deeper parts of San Francisco Bay, California, USA (beneath the Golden Gate Bridge), as well as in deeper bays of Oregon and Washington States (Compagno in prep. a). This species is widely believed not to be capable of sustaining either sport or commercial fisheries efforts. Attempts to develop directed fisheries for the bluntnose sixgill shark have rapidly collapsed in California waters, usually lasting less than three years (Compagno in prep. a). Attempts to manage the sport fishery for the hexanchids in San Francisco Bay have been hampered by unusual rules that did not regulate the catch of these sharks per boat, but rather set the quotas at fish per person-pole. It has not been uncommon to see boats on the Bay loaded "to the gunwales" with fishermen to justify the number of poles aboard. The sixgill shark population in San Francisco and Humboldt Bays of California and Puget Sound complex of Washington was considered to be in serious decline in 1995 as a result of fishery activity. Development of a fishery for bluntnose sixgill in British Columbia is being explored, as a replacement for other traditional bony fish and elasmobranch fisheries that are now in decline. This has proceeded despite strong concerns voiced by fishery biologists as to the unsustainability of such fisheries historically (K. Wolf pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The bluntnose six-gill shark is fished commercially and as a game fish throughout its range (3). However, the species seems unable to sustain target fisheries and is more usually taken as bycatch (1). The flesh is sold fresh, frozen and dried-salted for consumption, and is also utilised for oil and fishmeal (5). In parts of its range, including the Northeast Pacific, regional populations have depleted so much from fishing that they would be better classified as Vulnerable (A1bd+2bd) (1). Because of their relatively low reproductive rate these sharks are slow to rebound if over fished (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

As the bluntnose six-gill shark is relatively widespread and abundant, there is no legislation against the commercial fishing of this species. There are, however, new regulations being enacted prohibiting the recreational killing of these sharks in some areas of its range (2). The Food and Agriculture Organisation of the United Nations (FAO) have been working on an International Plan of Action for the conservation and management of sharks throughout the world (IPOA-SHARKS) (6), but the lack of sufficient population data on these sharks makes developing appropriate conservation management plans extremely difficult. Furthermore, being mainly deepwater sharks with shy demeanours, opportunities to study live specimens are rare (2). Thus, data on population numbers and distribution is urgently needed to enable this reclusive shark to be effectively monitored and protected.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Despite their size, these sharks are not considered much of a direct threat to humans. They are described as shy, nonagressive animals that pose no threat to humans unless physically provoked. Also, their preference for deep water and darkness makes human encounters with this species relatively rare.

Some medical professionals consider the liver of Hexanchus griseus to be toxic, as its ingestion has been known to cause painful sickness for up to 10 days. The skin of H. griseus has also been known to cause such sickness.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is killed for food, harvested with line gear, gill nets, and other equipment. It is also caught by game fishermen.

Since they are large and widespread animals, these sharkes they may have a significant role in deep-water fisheries, but we have no information on this.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bluntnose sixgill shark

The bluntnose sixgill shark, Hexanchus griseus, often simply called the cow shark, is the largest hexanchoid shark, growing to 4.8 m (16 ft) in length. This shark is one of the commonly studied deep-sea sharks, due to students using bait (tuna or carrion) to perform tests, to see how deep-sea fish find their food in the light-less world of the deep sea.

Taxonomy[edit]

The bluntnose sixgill shark is a member of the Hexanchidae family. Many of its relatives are extinct – it has more close relatives in the fossil record than living relatives. The related living species include the dogfish, the Greenland shark, and other six- and sevengilled sharks. Some of the shark's relatives date back 200 million years. This shark is a notable species due to both its primitive and current physical characteristics.

Description[edit]

Drawing of a bluntnose sixgill shark

Skin color ranges from tan to brown to black. It has a light-colored lateral line down the sides and on the fins' edges, and darker colored spots on the sides. The general shape is a heavy, powerful body with a broad head with small eyes. The pupils are black and the eye color is a fluorescent blue-green. The bluntnose sixgill shark can grow to 4.8 m (16 ft). Adult males generally average between 3.1 and 3.3 m (10 and 11 ft), while adult females average between 3.5 and 4.2 m (11 and 14 ft).

The bluntnose sixgill shark resembles many of the fossil sharks from the Triassic period. A greater number of Hexicanus relatives occur in the fossil record than are alive today. They have one dorsal fin located near the caudal fin. The pectoral fins are broad, with rounded edges. The six gill slits give the shark its name. Most common sharks today only have five gill slits.

Habitat[edit]

This species typically inhabits depths greater than 90 m (300 ft), and has been recorded as deep as 1,875 m (6,152 ft). Like many deep-sea creatures, the bluntnose sixgill shark is known to undertake nightly vertical migrations (travelling surfaceward at night, returning to the depths before dawn).

The bluntnose sixgill shark can be seen at depths of 30 m (98 ft) and shallower during parts of the year in some specific places, e.g. Flora Islet, near Hornby Island. These sharks have been seen as shallow as 12 m (40ft)in Barkley Sound on the West coast of Vancouver island. Sightings are made during shallow evening dives in Whytecliff Park West Vancouver in British Columbia, in Puget Sound,[1] Monterey Canyon off Monterey, California, and fjords in Norway. The sharks are deep-sea sharks, but like most fish that prefer the deep, they come to the shallower depths to feed.

Feeding patterns[edit]

Teeth of the bluntnose sixgill shark

Although sluggish in nature, the bluntnose sixgill shark is capable of attaining high speeds for chasing and catching its prey. Because of their large and diverse range, they have a wide variety of prey items. Their diet consists of a variety of mollusks, crustaceans, and hagfish and sea lampreys. They also dine on Cape anchovies, Pacific salmon, and various species of hake. Many other species are eaten depending upon the shark's home range. In the BBC's The Blue Planet (in the episode "The Deep" and the special "The Abyss"), this shark was filmed eating the remains of a yellowfin tuna. Although the bluntnose sixgill shark can grow to a great size, it has not been known to attack any humans.[citation needed] In 2013 during filming for the Shark Week episode "Alien Sharks", bluntnose sixgill sharks were found to be territorial as one was filmed laying claim to the carcass of a sperm whale calf that was being used to lure deep-sea shark species within range of submarine cameras. The shark was recognized as being the same individual by the scars on its back and sides, and the bites it removed from the carcass allowed other animals such as hagfish to feed and further break down the dead whale. [2]

Lower teeth

Reproduction[edit]

Very little is known about the reproductive process of bluntnose sixgill sharks. Many biologists believe the male bluntnose sixgill shark's teeth are specially adapted for courtship. The male nips at the female's gill slits using its longer-cusped teeth. This action is thought to entice the female into mating. Evidence of this hypothesis is that female bluntnose sixgill sharks show up with seasonal scars around their gill slits, which apparently is from breeding with males. The female bluntnose sixgill shark reaches sexual maturity between 18 and 35 years old. Males usually reach sexual maturity much younger, between 11 and 14 years old. Males and females are thought to meet seasonally between May and November. The gestation period is unknown, but is probably more than two years. The bluntnose sixgill shark is ovoviviparous - the young are carried within the mother's body until the eggs hatch. They develop without a placenta to provide nourishment. The pups are born at a fairly large and developed stage at 65 to 74 cm. New pups are also born with a lighter belly color than adults. This form of cryptic coloration or camouflage is used to disguise the pup's appearance. The litter size ranges from 22 to 108 pups. A high mortality rate of the young pups is presumed, owing to the large litter size.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!