Overview

Comprehensive Description

Biology

A common shark of the continental shelves (Ref. 9838), from close inshore at the intertidal zone to 275 m (Ref. 6871). Segregates by sex and maturity stage (Ref. 6871). Nocturnal, hides in caves and rocky gullies during the day (Ref. 6871). Feeds on benthic invertebrates, primarily echinoderms (Ref. 247). Oviparous (Ref. 50449). Eggs with spiral flanges but lack tendrils (Ref. 6871). Undergoes yearly migrations to spawning sites during breeding season (Ref. 247). Considered harmless to people, but can deliver a painful nip when provoked (Ref. 247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Port Jackson Shark is a common inhabitant of the Australian continental shelf south of 20°S. It has been recorded from estuarine areas, to depths of 245m (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: southern Australia (including Western Australia) and one record from New Zealand. Heterodontus bona-spei from South Africa probably refers to this species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Heterodontus portusjacksoni is one of the better known species of horn sharks (Heterodontus). It was named after Port Jackson in Sydney Harbour. They are found from southern coastal Australia to the central coast of Western Australia. Some have been found as far north as York Sound in Western Australia. According to studies of the genetics of the Port Jackson sharks, there are two different populations found in different regions that extend the length of the southern part of Australia.

Biogeographic Regions: australian (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia and New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Port Jackson sharks are the largest in the genus Heterodontus. At birth, they are 23 to 24 cm. Females are usually larger as these sharks mature. At adolescence, males are between 50 and 80 cm, whereas females range between 64 and 83 cm. The difference between females and males is seen when fully mature, when females can measure more than 123 cm and males more than 105 cm.

Their color is gray to light brown. They have a dark spot on their nose with a black bar running the length of their face as wide as the eye. There are black stripes that flow along the body, giving them the appearance of wearing a harness.

Port Jackson sharks have two dorsal fins with a spine at the tip. These are not venomous and can be very sharp when young, but usually dull with age. The spines can be found washed up on shores and are believed to be the origin for the name of the “horn sharks”.

Port Jackson sharks have two types of teeth: incisors for cutting and molars for crushing. They are ideal for holding, crushing, and breaking the shells of their crustacean and mollusk prey.

Range length: 25 to 170 cm.

Average length: 85 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Budker, P. 1971. The Life of Sharks. New York: Columbia University Press.
  • Whitley, G. 1940. The Fishes of Australia. Sydney: Royal Zoological Society N.S.W..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1650 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

165 cm TL (male/unsexed; (Ref. 247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Harness-like narrow dark stripes on back (Ref. 9838).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Acommon littoral, nocturnal bottom shark of the temperate Australian continental shelves and uppermost slopes, ranging from close inshore in the intertidal to at least 275 m.
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Port Jackson Sharks feed mostly on benthic invertebrates, especially sea urchins (Last and Stevens 1994). Other reported prey include sea stars, polychaete worms, gastropods, prawns, crabs and small fish (Compagno 1984a).
The Port Jackson shark is oviparous, with mature females producing 10?16 eggs each year. The eggs are deposited in fissures and caves of shallow rocky reefs. Juveniles hatch at a size of 23 cm from the eggs after 12 months. Males mature at an age of 8?10 years at a size of 75 cm, while females mature at 11?14 years and 80?95 cm. These ages at maturity are based on captive animals and the age and growth of the wild population needs to be examined to confirm these estimates. Males grow to a maximum size of 105 cm; females grow to at least 123 cm (McGaughlin and O?Gower 1971, Last and Stevens 1994).

Port Jackson sharks are abundant inhabitants of coastal reefs throughout their ranges (Last and Stevens 1994). They are most active at night when they are feeding. McGaughlin and O?Gower (1971) gave a detailed description of the habitat use and movements of Port Jackson sharks in the waters off New South Wales. Males and females move into inshore reef areas in July. Mating occurs in July and August and eggs are laid in August and September. At the end of the breeding season males move into deeper water, followed by females at the end of their egg laying period. Some adults remain offshore over summer, while others migrate. Animals have been recorded up to 850 km from the reproductive areas. Females appear to migrate further than males. Juveniles hatch in the nearshore reef areas and normally remain there until they near maturity.

McGaughlin and O?Gower (1971) estimated that the growth rates of captive animals were 5?6 cm for juveniles and 2?4 cm for adults.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 0 - 275 m (Ref. 26346)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Port Jackson sharks live in tropical marine waters usually near the bottom of rocky environments. They tend to be found in caves with sandy bottoms. They are nocturnal, bottom-dwelling sharks and are commonly found in depths of 100 meters, but have been found up to 275 meters. Some have been found in muddy areas with sea grass.

Range depth: 100 to 275 m.

Average depth: 100 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 68 specimens in 1 taxon.
Water temperature and chemistry ranges based on 49 samples.

Environmental ranges
  Depth range (m): 18 - 241
  Temperature range (°C): 12.830 - 18.371
  Nitrate (umol/L): 0.072 - 5.871
  Salinity (PPS): 35.232 - 36.070
  Oxygen (ml/l): 4.570 - 5.650
  Phosphate (umol/l): 0.120 - 0.576
  Silicate (umol/l): 0.881 - 2.652

Graphical representation

Depth range (m): 18 - 241

Temperature range (°C): 12.830 - 18.371

Nitrate (umol/L): 0.072 - 5.871

Salinity (PPS): 35.232 - 36.070

Oxygen (ml/l): 4.570 - 5.650

Phosphate (umol/l): 0.120 - 0.576

Silicate (umol/l): 0.881 - 2.652
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 275m.
Recorded at 275 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Port Jackson sharks feed primarily on invertebrates, mainly echinoderms. They eat sea urchins, starfish, polychaetes, large gastropods, prawns, crabs, barnacles, and small fishes. Juveniles, with their smaller, more pointed teeth, apparently take more soft-bodied prey than adults. Food items in stomachs are usually broken into small pieces, which show how the powerful molar-like teeth grind the food. Food is apparently taken at night on the ocean bottom. Juveniles dig food out of the sand by sucking in water and sand and blowing it out of the gill covers.

Respiration can occur by pumping water into the first of the enlarged gill slits and out the last four, which is thought to allow the shark to crush and grind its prey at leisure without having to take in water through its mouth and risk food leaving the gill slits.

Animal Foods: fish; mollusks; aquatic crustaceans; echinoderms; other marine invertebrates

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

There are several known parasites of Port Jackson sharks, including parasitic isopods. Port Jackson sharks are important predators of echinoderms and crustaceans. Through predation on echinoderms it is likely that they positively influence populations of mollusks and algae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The adults seem to be well protected by their sedentary habits, cryptic coloration, nocturnal behavior, fin spines, and disruptive color patterns. Some predators are large sharks such as great white sharks (Carcharodon carcharias) as well as sea lions (Otariidae). Juveniles in nursery grounds are more vulnerable to predation by other sharks. Eggs may be eaten by male Port Jackson sharks.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

feeds primarily on benthic invertebrates, mainly echinoderms. Prey items include sea urchins, starfish, polychaetes, large gastropods, prawns, crabs, barnacles, and small fishes. Occasionally garbage such as bits of mammalian fur, potato and orange peels are taken in by these sharks.
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Port Jackson sharks, like other sharks, probably have keen chemosensation and can detect small movements in the water with tactile organs. Nothing is known about communication in these sharks.

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous. Distinct pairing with embrace (Ref. 205). Undergoes yearly migrations to breeding sites. Females lay about 10 to 16 (commonly 10-12) eggs in rock crevices on shallow sheltered reefs at depths of 1-5 m (rarely 20-30 m) during August and September (rarely in July and October). In captivity, females lay 2 eggs a day every 8-17 days. Eggs are hatched after 9-12 months and young then move into nursery areas in bays and estuaries. After the breeding season, males move into deeper waters followed by the females in late September or October.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Port Jackson sharks deposit their egg cases and then wedge them into rock crevices. The eggs develop into juvenile sharks in the egg case and then emerge after 10 to 12 months. After the young sharks are born, they move into nursery areas in bays and estuaries where they remain until maturity. Juvenile Port Jackson sharks remain in mixed sex groups for several years. After a few years, the young move into deeper waters and separate into female and male groups.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

No information on lifespan was found for Port Jackson sharks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mature female Port Jackson sharks move to inshore reefs accompanied by some males beginning in July and August. They mate on coastal reefs and of the coast of New South Wales. Many males do not participate in breeding and remain in deeper water offshore. Breeding sharks congregate in caves but little is known about courtship and pair formation.

Port Jackson sharks are oviparous. During August and September, females lay 10 to 16 eggs in shallow reefs at depths of 5 to 30 meters. The egg cases are brown, spiraled structures that the females wedge into rock crevices. Females will hold an egg case in their mouth and insert it into a safe crevice. Females usually use the same breeding sites each year. Port Jackson sharks have been seen eating their own egg cases, but they have never been seen breeding. The young hatch out of the egg case after 10 to 12 months.

Breeding interval: Port Jackson sharks breed once yearly.

Breeding season: Port Jackson sharks breed seasonally, in July and August.

Range number of offspring: 10 to 16.

Average number of offspring: 12.

Range gestation period: 9 to 12 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Once the female has layed her eggs, along with a supply of nutrients in the yolk sac, and placed them in safe rock crevices to develop, there is no further parental involvement.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

  • Budker, P. 1971. The Life of Sharks. New York: Columbia University Press.
  • Rogers, C. 2000. Port Jackson Sharks. Nature Australia, 10: 26-33.
  • McGrouther, M. 2005. "Port Jackson Shark, Heterodontus portjacksoni" (On-line). Fishes: Australian Museum Fish Site. Accessed March 06, 2006 at http://www.amonline.net.au/fishes/students/focus/heter.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heterodontus portusjacksoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTGATCTTTGGTGCATGAGCTGGAATAGTAGGGACAGCTTTAAGTTTACTTATCCGAGCTGAACTAAGCCAGCCTGGGTCTCTTCTAGGTGATGACCAAATCTATAATGTTATTGTAACTGCCCATGCTTTTGTAATGATCTTTTTTATAGTTATACCTGTAATGATTGGAGGGTTTGGCAATTGACTTGTTCCATTAATAATCGGTGCCCCCGACATGGCCTTCCCACGAATAAATAACATAAGCTTTTGGCTTCTCCCACCCTCCTTTCTTTTACTCCTGGCTTCAGCTGGAGTTGAAGCAGGAGCTGGAACTGGCTGAACAGTTTACCCCCCTTTAGCTGGCAACCTAGCCCATGCCGGAGCGTCCGTAGACTTGGCAATCTTCTCCTTACACTTAGCTGGTATTTCATCAATCTTAGCCTCAATCAACTTTATTACAACCATTATTAACATAAAACCCCCAGCCATCTCCCAATACCAAACGCCCTTGTTTGTCTGATCAATCCTTGTAACCACCGTCCTCCTTTTACTTTCACTTCCTGTTTTAGCAGCTGGAATTACGATACTACTAACCGACCGTAATCTAAATACAACATTCTTTGATCCTGCTGGCGGAGGAGATCCTATTCTATACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Heterodontus portusjacksoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2005

Assessor/s
Simpfendorfer, C.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

This abundant shark is endemic to Australian waters. There is currently no evidence to suggest that Port Jackson Shark (Heterodontus portusjacksoni) populations face any risk of extinction. Although caught in commercial fisheries in substantial quantities most are returned to the water alive. Habitat modification and other environmental factors do not appear to be a threat to the health of populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Port Jackson sharks are not considered threatened currently.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Port Jackson Sharks are commonly caught in demersal gillnet fisheries operating in southern Australia. At times they may account for the majority of the catch (in numbers). Catch figures, however, are unavailable as fishermen do not land this species. Their flesh and fins are considered of poor quality and they are not used commercially. Most are discarded, often alive. Some fishers consider them to be a pest and kill them before discarding them. Observations on catches of demersal gillnet fishers in southern Western Australia have indicated that stocks remain relatively healthy, with large catches regularly made after 20 years of intensive fishing (Simpfendorfer unpubl.).

Small individuals are captured for use in the hobbyist aquarium trade and fetch good prices. Live animals are sold both domestically and internationally. Port Jackson Sharks advertised by aquarium suppliers in the US sell for up to US$180. Specimens are also collected by commercial aquaria for display purposes, but in relatively small numbers. Large commercial aquariums are able to successfully breed Port Jackson Sharks in captivity, reducing the reliance on wild caught animals.

Recreational fishers occasionally catch Port Jackson Sharks, but they are not specifically targeted because of their low flesh quality. A survey of recreational boat anglers on the lower west coast of Western Australia estimated that the recreational catch by this sector of the recreational fishery was 273 individuals in the period from September 1996 to August 1997 (N. Sumner pers. comm.). These levels of catch are very minor when compared to commercial catches.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The only specific management regulation that exists for Port Jackson Sharks is the recreational trip limit for sharks imposed by Western Australia (four of any species). No other States have bag or size limits that cover Port Jackson Sharks. Commercial collectors of live specimens for the aquarium trade are normally licensed by State Governmental legislation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Port Jackson sharks are considered harmless to people.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Port Jackson sharks are important members of healthy marine ecosystems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Port Jackson shark

The Port Jackson shark (Heterodontus portusjacksoni) is a nocturnal, oviparous (egg laying) type of bullhead shark of the family Heterodontidae, found in the coastal region of southern Australia, including the waters off Port Jackson. It has a large, blunt head with prominent forehead ridges and dark brown harness-like markings on a lighter grey-brown body, and can grow up to 1.67 metres (5.5 ft) long.[1]

The Port Jackson shark is a migratory species, traveling south in the summer and returning north to breed in the winter months. It feeds on hard-shelled mollusks, crustaceans, sea urchins, and fish. Identification of this species is very easy due to the pattern of harness-like markings which cross the eyes, run along the back to the first dorsal fin, then cross the side of the body, in addition to the spine in front of both dorsal fins.

Distribution and habitat[edit]

The Port Jackson shark is endemic to the temperate waters around southern Australia and can be found in an area stretching from southern Queensland, south to Tasmania, and west to the central coast of Western Australia. There are dubious reports of catchings as far north as Western Australia's York Sound and, on one occasion, it has occurred off the coast of New Zealand. Genetic studies suggest there may be two Australian groups, one found from Northeastern Victoria to Western Australia and the second found from Southern Queensland to New South Wales. The species is believed to have originated somewhere off the coast of South Africa.[2] It usually lives less than 100 metres (330 ft) of water, but has been known to go as deep as 275 metres (902 ft).[3]

The shark's territory is habitually sited on, or near, the sea bottom, which is also its feeding area. Rocky environments are the most common habitat, though sandy and muddy ones, as well as seagrass beds, are sometimes used.[3] During the day, when it is usually not active, it can be found in flat areas which offer some shelter from currents (including caves)[4] or near other sheltering positions such as rocky outcrops.

Appearance[edit]

Port Jackson sharks are similar to others of their genus, bearing a broad, blunt, flat head, an anal fin, and crests above its eyes. However, the species possesses characteristics that make them easily identifiable, such as their teeth and the harness-like markings which run for a majority of their body length. These markings runs from their eyes to their first dorsal fin and then across the rest of their body. Both of its dorsal fins are of close to equal size, each with a spine at the foremost edge. These spines are rumored to be poisonous.[3] Other features that help distinguish them are their small mouths as well as their nostrils, which are connected to their mouth.[4]

The sharks have gray-brown bodies covered by black banding, which covers a large portion of their sides and back. One of these band winds over the face and progresses even to the shark's eyes. Another harness shaped band goes around the back, continuing until the pectoral fins and sides. Thin dark stripes are also present on the back of Port Jackson sharks. These progress from the caudal fin to the first dorsal fin.[4]

Two Port Jackson Sharks, demonstrating "harness" feature.

Teeth[edit]

The teeth of the Port Jackson shark are one of its most distinguishable feature. Unlike other sharks, its teeth are different in the front and back. The frontal teeth are small, sharp and pointed, while the latter is flat and blunt. These teeth function to hold and break, then crush and grind the shells of the mollusks and echinoderms that this species feeds upon. Juveniles of the species have teeth that are sharper and their diet has a higher proportion of soft-bodied prey than adults.[3]

Mouth of a Port Jackson shark showing teeth and crushing plate

Respiratory system[edit]

The Port Jackson shark has five gills, the first supports only a single row of gill filaments, while the remaining four support double rows of filaments. Each of the second to the fifth gill arches supports a sheet of muscular and connective tissue called a septum. The shark possesses behind each eye an accessory respiratory organ called a spiracle. Along the top and bottom of each gill filament are delicate, closely packed, transverse flaps of gill tissue known as secondary lamellae. It is these lamellae that are the actual sites of gas exchange. Each lamella is equipped with tiny arteries that carry blood in a direction opposite to that of the water flowing over them. To compensate for the relatively low concentration of dissolved oxygen in seawater, water passes over the secondary lamellae of sharks some 20 times more slowly than air remains in contact with the equivalent gas exchange sites, such as the alveoli of the lungs found in humans. This delay allows sufficient time for dissolved oxygen to diffuse into a shark's blood.

Port Jackson sharks have the ability to eat and breathe at the same time. This ability is unusual for sharks which mostly need to swim with the mouth open to force water over the gills. The Port Jackson shark can pump water into the first enlarged gill slit and out through the other four gill slits. By pumping water across the gills, the shark does not need to move to breathe. It can lie on the bottom for long periods of time.

Reproduction[edit]

Male Port Jackson sharks become sexually mature between ages 8 and 10, and females at 11 through 14. They are oviparous, meaning that they lay eggs rather than give live birth to their young. The species has an annual breeding cycle which begins in late August and continues until the middle of November. During this time the female lays pairs of eggs every 10 to 14 days. As many as 8 pairs can be laid during this period. The eggs mature for 10–11 months before the hatchlings, known as neonates, can break out of the egg capsule. The eggs have been assessed in recent studies as having an 89.1% mortality rate, mostly from predation.[4]

Digestive system[edit]

Digestion of food can take a long time in the Port Jackson shark. Food moves from the mouth to the 'J' shaped stomach, where it is stored and initial digestion occurs. Unwanted items may never get any further than the stomach, and are coughed up again. They have the ability to turn their stomachs inside out and spit it out of their mouths in order to get rid of any unwanted contents. One of the biggest differences in digestion in the shark when compared to mammals is the extremely short intestine. This short length is achieved by the spiral valve with multiple turns within a single short section instead of a very long tube-like intestine. The valve provides a very long surface area for the digestion of food, requiring it to pass around inside the apparently short gut until fully digested, when remaining waste products pass by. The most obvious internal organ in sharks is the huge liver, which often fills most of the body cavity. Dietary items include sea urchins, molluscs, crustaceans and fishes. Black sea urchins (Centrostephanus rodgersii) are often eaten. Port Jackson Sharks forage for food at night when their prey are most active. They often use caves and rocky outcrops as protection during the day. When most people think of shark teeth, they think of large, sharp teeth like those in the film 'Jaws'. Not all sharks have teeth like these. The teeth of the Port Jackson Shark are very different. They are not serrated, and the front teeth have a very different shape from those found at the back of the jaws, hence the genus name Heterodontus (from the Greek heteros, meaning 'different', and dont, meaning 'tooth'). The anterior teeth are small and pointed, whereas the posterior teeth are broad and flat. The teeth function to hold and break, then crush and grind the shells of molluscs and echinoderms. Juvenile Port Jackson Sharks have more pointed teeth and feed on a higher proportion of soft-bodied prey than adults. They can feed by sucking in water and sand from the bottom, blowing the sand out of the gill slits, and retaining the food, which is swallowed.

Relationship with humans[edit]

The shark has no major importance to humans. It is not an endangered species and is not utilized as a common food supply. It is, however, useful when scientists are hoping to study bottom-dweller sharks and can be vulnerable to being caught as bycatch. It also does not pose any danger to humans. [4] In October 2011 a man was 'bitten' by a Port Jackson shark at Elwood Beach near Melbourne. The bite did not pierce the skin and the man was able to swim away while the shark was latched on to his calf.[5]

Conservation[edit]

Although listed as "Least Concern" on the World Conservation Union (IUCN) Red List, it is known that the shark's egg capsules experience very high mortality rates (estimated at 89.1%). Its status is otherwise largely unknown. Predators of the species are also unknown. Though Crested bullhead shark (Heterodontus galeatus) are known to prey upon Port Jackson shark embryos, the biggest threat is probably from other sharks such as white sharks and the broadnose sevengill shark (Notorynchus cepedianus).[4]

Gallery[edit]

References[edit]

  1. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5. 
  2. ^ Burton, p. 2027.
  3. ^ a b c d M. McGrouther (October 2006). "Port Jackson Shark". Australian Museum. Retrieved March 26, 2009. 
  4. ^ a b c d e f Rebecca Sarah Thaler. "Port Jackson Shark". Florida Museum of Natural History. Retrieved March 27, 2009. 
  5. ^ http://www.heraldsun.com.au/news/more-news/man-bitten-by-shark-at-elwood-beach/story-fn7x8me2-1226170943972

Bibliography[edit]

  • Robert Burton (2002). International Wildlife Encyclopedia. Marshall Cavendish. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!