Overview

Comprehensive Description

Biology

A common shark of the continental shelves (Ref. 9838), from close inshore at the intertidal zone to 275 m (Ref. 6871). Segregates by sex and maturity stage (Ref. 6871). Nocturnal, hides in caves and rocky gullies during the day (Ref. 6871). Feeds on benthic invertebrates, primarily echinoderms (Ref. 247). Oviparous (Ref. 50449). Eggs with spiral flanges but lack tendrils (Ref. 6871). Undergoes yearly migrations to spawning sites during breeding season (Ref. 247). Considered harmless to people, but can deliver a painful nip when provoked (Ref. 247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Port Jackson Shark is a common inhabitant of the Australian continental shelf south of 30S from Byron Bay (New South Wales) to the Houtman Abrolhos (Western Australia), including Tasmania. Records from York Sound (northern Western Australia) and Moreton Bay (Queensland) are questionable. The only record from New Zealand comes from one individual (Last and Stevens 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Heterodontus portusjacksoni is one of the better known species of horn sharks (Heterodontus). It was named after Port Jackson in Sydney Harbour. They are found from southern coastal Australia to the central coast of Western Australia. Some have been found as far north as York Sound in Western Australia. According to studies of the genetics of the Port Jackson sharks, there are two different populations found in different regions that extend the length of the southern part of Australia.

Biogeographic Regions: australian (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: southern Australia (including Western Australia) and one record from New Zealand. Heterodontus bona-spei from South Africa probably refers to this species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia and New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Port Jackson sharks are the largest in the genus Heterodontus. At birth, they are 23 to 24 cm. Females are usually larger as these sharks mature. At adolescence, males are between 50 and 80 cm, whereas females range between 64 and 83 cm. The difference between females and males is seen when fully mature, when females can measure more than 123 cm and males more than 105 cm.

Their color is gray to light brown. They have a dark spot on their nose with a black bar running the length of their face as wide as the eye. There are black stripes that flow along the body, giving them the appearance of wearing a harness.

Port Jackson sharks have two dorsal fins with a spine at the tip. These are not venomous and can be very sharp when young, but usually dull with age. The spines can be found washed up on shores and are believed to be the origin for the name of the “horn sharks”.

Port Jackson sharks have two types of teeth: incisors for cutting and molars for crushing. They are ideal for holding, crushing, and breaking the shells of their crustacean and mollusk prey.

Range length: 25 to 170 cm.

Average length: 85 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Budker, P. 1971. The Life of Sharks. New York: Columbia University Press.
  • Whitley, G. 1940. The Fishes of Australia. Sydney: Royal Zoological Society N.S.W..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1650 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

165 cm TL (male/unsexed; (Ref. 247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Harness-like narrow dark stripes on back (Ref. 9838).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

The Port Jackson Shark is an abundant inhabitant of coastal reefs throughout its range, mainly on the continental shelf from close inshore to depths of 275 m (Last and Stevens 2009). It is most active at night when feeding. McGaughlin and O'Gower (1971) gave a detailed description of the habitat use and movements of the Port Jackson Shark in the waters off New South Wales. Since then, several PhD theses investigated various aspects of the species' ecology and biology (Rodda 2000, Tovar-Avila2006, Powter 2007, Ramos 2007, Bass 2012). Powter (2007) describedthe Port Jackson Sharkas usingmostly shallow (3.5-13.5 m deep) coastal rocky reefs dominated by areas of barren and kelp habitat with adjacent sand flats.

Conventional tagging showed that the Port Jackson Shark is capable of large-scale movements between central New South Wales and Tasmania (O'Gower1995), with individuals having been recorded up to 850 km from the reproductive areas.It is suggested thatthe speciesmigrates south at the end of the breeding season to spend the summer and autumn in the deeper waters of the Bass Strait (O'Gower and Nash 1978). Its northward movement is believed to occur in deeper offshore waters becauseit is rarely caught on longline in water less than 60 m deep and closer than 25 km from shore before August/September (Powter 2007). However, McLaughlin (1969) conceded that the species' movements constituted a complex pattern that was not solely a movement from, and return to, specific breeding sites. This is supported by a recent acoustic tracking study showing that only ~15% of tagged individuals migrated south after breeding (C. Brown and N. Bass, pers. comm., February 2015). The lack of detections on any of the extensive Australian acoustic network receivers from the rest of the tagged animals suggest that the species might travel offshore where no receivers have been deployed. During the breeding season, the Port Jackson Shark exhibits a high level of site fidelity, with males and females spending about 90 and 85% of their time, respectively, on a single breeding reef and coming back to the same sites year after year (C. Brown and N. Bass,pers. comm., February 2015). A high level of site fidelity was also observed in Spencer Gulf (Rodda 2007). Juveniles hatch in nearshore reef areas and normally remain there until they near maturity.

This species attains approximately 165 cm total length (TL). Strong sexual dimorphism occurs with males maturing at a smaller size than females across the species' range (Powter and Gladstone 2008, Izzo and Rodda 2012). In addition, size at maturity differs betweenregions.The largest sexual dimorphism in the species occur in Western Australia, where males mature at 58-65 cm TL and females at 80-90 cm TL. In South Australia, males mature at 55-57.5 and females at 65-75 cm TL. In Victoria, males mature at 67.5-82 and females at 85-99 cm TL, and in New South Wales, males mature at 60-77 and females at 90-91 cm TL (Izzo and Rodda 2012). Size at birth also varies between regions from 18-21 cm TL in Western Australia up to 29.5-31.5 cm TL in Victoria. Females produce 10-16 eggs each year, with a mean ovarian fecundity of 16 (Powter and Gladstone 2008). Fecundity does not increase with TL (Powter and Gladstone 2008). The Port Jackson Sharkhas a synchronous annual breeding season throughout its range. Oviposition occur in fissures and caves of shallow rocky reefs during the Austral winter to spring, peaking in August-October, with hatching occurring 10-11 months later (Powter and Gladstone 2008, Rodda and Seymour 2008).

Similar to size at maturity, growth curves and ensuing age at maturity varies between sexes and regions (Izzo and Rodda 2012).In South Australia, males mature at about 6 and females at about 7-8 years old. In Victoria and New South Wales, males mature at about 7-12 and females at 12-17 years old (Powter 2007, Tovar-Avila et al.2009, Izzo and Rodda 2012).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 68 specimens in 1 taxon.
Water temperature and chemistry ranges based on 49 samples.

Environmental ranges
  Depth range (m): 18 - 241
  Temperature range (°C): 12.830 - 18.371
  Nitrate (umol/L): 0.072 - 5.871
  Salinity (PPS): 35.232 - 36.070
  Oxygen (ml/l): 4.570 - 5.650
  Phosphate (umol/l): 0.120 - 0.576
  Silicate (umol/l): 0.881 - 2.652

Graphical representation

Depth range (m): 18 - 241

Temperature range (°C): 12.830 - 18.371

Nitrate (umol/L): 0.072 - 5.871

Salinity (PPS): 35.232 - 36.070

Oxygen (ml/l): 4.570 - 5.650

Phosphate (umol/l): 0.120 - 0.576

Silicate (umol/l): 0.881 - 2.652
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Acommon littoral, nocturnal bottom shark of the temperate Australian continental shelves and uppermost slopes, ranging from close inshore in the intertidal to at least 275 m.
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Acommon littoral, nocturnal bottom shark of the temperate Australian continental shelves and uppermost slopes, ranging from close inshore in the intertidal to at least 275 m.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Port Jackson sharks live in tropical marine waters usually near the bottom of rocky environments. They tend to be found in caves with sandy bottoms. They are nocturnal, bottom-dwelling sharks and are commonly found in depths of 100 meters, but have been found up to 275 meters. Some have been found in muddy areas with sea grass.

Range depth: 100 to 275 m.

Average depth: 100 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 0 - 275 m (Ref. 26346)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 68 specimens in 1 taxon.
Water temperature and chemistry ranges based on 49 samples.

Environmental ranges
  Depth range (m): 18 - 241
  Temperature range (°C): 12.830 - 18.371
  Nitrate (umol/L): 0.072 - 5.871
  Salinity (PPS): 35.232 - 36.070
  Oxygen (ml/l): 4.570 - 5.650
  Phosphate (umol/l): 0.120 - 0.576
  Silicate (umol/l): 0.881 - 2.652

Graphical representation

Depth range (m): 18 - 241

Temperature range (°C): 12.830 - 18.371

Nitrate (umol/L): 0.072 - 5.871

Salinity (PPS): 35.232 - 36.070

Oxygen (ml/l): 4.570 - 5.650

Phosphate (umol/l): 0.120 - 0.576

Silicate (umol/l): 0.881 - 2.652
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 275m.
Recorded at 275 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Port Jackson sharks feed primarily on invertebrates, mainly echinoderms. They eat sea urchins, starfish, polychaetes, large gastropods, prawns, crabs, barnacles, and small fishes. Juveniles, with their smaller, more pointed teeth, apparently take more soft-bodied prey than adults. Food items in stomachs are usually broken into small pieces, which show how the powerful molar-like teeth grind the food. Food is apparently taken at night on the ocean bottom. Juveniles dig food out of the sand by sucking in water and sand and blowing it out of the gill covers.

Respiration can occur by pumping water into the first of the enlarged gill slits and out the last four, which is thought to allow the shark to crush and grind its prey at leisure without having to take in water through its mouth and risk food leaving the gill slits.

Animal Foods: fish; mollusks; aquatic crustaceans; echinoderms; other marine invertebrates

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

There are several known parasites of Port Jackson sharks, including parasitic isopods. Port Jackson sharks are important predators of echinoderms and crustaceans. Through predation on echinoderms it is likely that they positively influence populations of mollusks and algae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The adults seem to be well protected by their sedentary habits, cryptic coloration, nocturnal behavior, fin spines, and disruptive color patterns. Some predators are large sharks such as great white sharks (Carcharodon carcharias) as well as sea lions (Otariidae). Juveniles in nursery grounds are more vulnerable to predation by other sharks. Eggs may be eaten by male Port Jackson sharks.

Known Predators:

  • Great White Sharks Carcharodon carcharias 
  • sea lions (Otariidae)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

feeds primarily on benthic invertebrates, mainly echinoderms. Prey items include sea urchins, starfish, polychaetes, large gastropods, prawns, crabs, barnacles, and small fishes. Occasionally garbage such as bits of mammalian fur, potato and orange peels are taken in by these sharks.
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

feeds primarily on benthic invertebrates, mainly echinoderms. Prey items include sea urchins, starfish, polychaetes, large gastropods, prawns, crabs, barnacles, and small fishes. Occasionally garbage such as bits of mammalian fur, potato and orange peels are taken in by these sharks.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Port Jackson sharks, like other sharks, probably have keen chemosensation and can detect small movements in the water with tactile organs. Nothing is known about communication in these sharks.

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Port Jackson sharks deposit their egg cases and then wedge them into rock crevices. The eggs develop into juvenile sharks in the egg case and then emerge after 10 to 12 months. After the young sharks are born, they move into nursery areas in bays and estuaries where they remain until maturity. Juvenile Port Jackson sharks remain in mixed sex groups for several years. After a few years, the young move into deeper waters and separate into female and male groups.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oviparous. Distinct pairing with embrace (Ref. 205). Undergoes yearly migrations to breeding sites. Females lay about 10 to 16 (commonly 10-12) eggs in rock crevices on shallow sheltered reefs at depths of 1-5 m (rarely 20-30 m) during August and September (rarely in July and October). In captivity, females lay 2 eggs a day every 8-17 days. Eggs are hatched after 9-12 months and young then move into nursery areas in bays and estuaries. After the breeding season, males move into deeper waters followed by the females in late September or October.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

No information on lifespan was found for Port Jackson sharks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mature female Port Jackson sharks move to inshore reefs accompanied by some males beginning in July and August. They mate on coastal reefs and of the coast of New South Wales. Many males do not participate in breeding and remain in deeper water offshore. Breeding sharks congregate in caves but little is known about courtship and pair formation.

Port Jackson sharks are oviparous. During August and September, females lay 10 to 16 eggs in shallow reefs at depths of 5 to 30 meters. The egg cases are brown, spiraled structures that the females wedge into rock crevices. Females will hold an egg case in their mouth and insert it into a safe crevice. Females usually use the same breeding sites each year. Port Jackson sharks have been seen eating their own egg cases, but they have never been seen breeding. The young hatch out of the egg case after 10 to 12 months.

Breeding interval: Port Jackson sharks breed once yearly.

Breeding season: Port Jackson sharks breed seasonally, in July and August.

Range number of offspring: 10 to 16.

Average number of offspring: 12.

Range gestation period: 9 to 12 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Once the female has layed her eggs, along with a supply of nutrients in the yolk sac, and placed them in safe rock crevices to develop, there is no further parental involvement.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

  • Budker, P. 1971. The Life of Sharks. New York: Columbia University Press.
  • McGrouther, M. 2005. "Port Jackson Shark, Heterodontus portjacksoni" (On-line). Fishes: Australian Museum Fish Site. Accessed March 06, 2006 at http://www.amonline.net.au/fishes/students/focus/heter.htm.
  • Rogers, C. 2000. Port Jackson Sharks. Nature Australia, 10: 26-33.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heterodontus portusjacksoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTGATCTTTGGTGCATGAGCTGGAATAGTAGGGACAGCTTTAAGTTTACTTATCCGAGCTGAACTAAGCCAGCCTGGGTCTCTTCTAGGTGATGACCAAATCTATAATGTTATTGTAACTGCCCATGCTTTTGTAATGATCTTTTTTATAGTTATACCTGTAATGATTGGAGGGTTTGGCAATTGACTTGTTCCATTAATAATCGGTGCCCCCGACATGGCCTTCCCACGAATAAATAACATAAGCTTTTGGCTTCTCCCACCCTCCTTTCTTTTACTCCTGGCTTCAGCTGGAGTTGAAGCAGGAGCTGGAACTGGCTGAACAGTTTACCCCCCTTTAGCTGGCAACCTAGCCCATGCCGGAGCGTCCGTAGACTTGGCAATCTTCTCCTTACACTTAGCTGGTATTTCATCAATCTTAGCCTCAATCAACTTTATTACAACCATTATTAACATAAAACCCCCAGCCATCTCCCAATACCAAACGCCCTTGTTTGTCTGATCAATCCTTGTAACCACCGTCCTCCTTTTACTTTCACTTCCTGTTTTAGCAGCTGGAATTACGATACTACTAACCGACCGTAATCTAAATACAACATTCTTTGATCCTGCTGGCGGAGGAGATCCTATTCTATACCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Heterodontus portusjacksoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
Huveneers, C. & Simpfendorfer, C.

Reviewer/s
Walls, R.H.L. & Kyne, P.M.

Contributor/s
Walls, R.H.L.

Justification
The Port Jackson Shark (Heterodontus portusjacksoni)is a medium-sized (to 165 cm total length), abundant shark endemic to Australian waters, with one vagrant recorded in New Zealand. Although the Port Jackson Shark is a large bycatch component of several fisheries across its range,most individuals are returned to the water alive andpost-release stress studies have shown that the species is very resilient to capture stress from gillnet, trawl,and longline gear, suggesting high post-release survival rates. The estimated decline of the Port Jackson Shark in Bass Strait between 1973-74 and 1998-2001 has now ceased and has been reversed as fishers no longer persecute the species. This decline was only observed in a small proportion of the species' range and standardized catch-per-unit-effort from an observer program does not support the decline observed in the shark abundance surveys. In addition, a rapid semi-quantitative ecological risk assessment method showed that the Port Jackson Shark is at low risk from several fisheries because of its low catch susceptibility. The effects of fisheries on the Port Jackson Shark in other parts of its distribution are likely to be negligibleand habitat modification and other environmental factors do not appear to be a threat to the health of the population.There is currently no evidence to suggest that the Port Jackson Shark faces any risk of extinction, justifying a listing of Least Concern.

History
  • Least Concern (LC)
  • 2000
    Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Port Jackson sharks are not considered threatened currently.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

A well-known and abundant temperate species, with no evidence of population decline in most of its range.

Surveys of shark population abundance caught as part of the Gillnet, Hook and Trap Sector (GHAT) (part of the Southern and Eastern Scalefish and Shark Fishery, SESSF) indicate that the number of Port Jackson Sharks in Bass Strait declined from 701 individuals caught per 1,000 km lift hours (standard error; s.e. = 180) in 1973-76 to 169 (s.e. = 40) in 1998-2001 (Bracciniet al.2009). The most recent survey performed in 2007-08 reported 204 individuals per 1,000 km lift hours (s.e. = 75) and suggest that the decline has now ceased (Bracciniet al.2009). Overall, this represents an estimated population decline of 70.9% in 36 years. However, standardised catch per unit effort from the Integrated Scientific Monitoring Program (ISMP) data of the Great Australian Bight and Commonwealth Trawl Sectors between 1994 and 2006 does not show any declining trends (Walker and Gason 2007). This is supported by a rapid semi-quantitative ecological risk assessment method indicating that the Port Jackson Shark is at low risk to all fishing methods in far-eastern Victoria because of its low catch susceptibility (Tovar-Avila et al. 2010).

Differences ingrowth curves have been documented between the Port Jackson Shark from the two biogeographic zones suggested by O'Gower and Nash (1978). However, length ranges and size at maturity overlapped between bioregions, not supporting the presence of subpopulations across the distribution of the Port Jackson Shark (Izzo and Rodda 2012). Recent tracking data, however,suggests high site fidelity, with only ~15% of individuals migrating (C. Brown and N. Bass,pers. comm., February 2015). Genetics analyses are currently underway to assess the population structure of Port Jackson Sharks (C. Brown and N. Bass,pers. comm., February 2015).


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

The Port Jackson Shark is caught as bycatch by a range of fisheries throughout its distribution, sometimes in high numbers. Their flesh and fins are considered of poor quality across their distribution. The Port Jackson Shark is therefore rarely used commercially, resulting in most specimens being discarded in all fisheries catching them (Walkeret al.2005, Walker and Gason 2007, Ryan et al. 2013), often alive.Catch figures are mostly unavailable as fishers do not land this species.

In New South Wales, the Port Jackson Shark is caught as bycatch in the prawn trawl fishery mainly off the central coast north of Sydney, but no catch information is recorded (D. Powter, pers. comm., February 2015).

This species is caught as bycatch in theGillnet, Hook and Trap Sector (GHAT)of the Southern and Eastern Scalefish and Shark Fishery (SESSF). As it is not retained, information about catches is only available from fisheries-dependent or -independent surveys of shark populations (e.g., Bracciniet al.2009). The likelihood of capture is affected by mesh selectivity, withthe Port Jackson Sharkbeing less susceptible to gillnet mesh sizes of six inches and lower (Walkeret al. 2005). The probability of being caught in the GHAT has decreased as 7- and 8-inch gillnets were phased out in the early 1980s. More recently, the use of 6.5 inch gillnets in the GHAT is also declining as the region mostly using this gillnet size (i.e., South Australia) is frequently affected by temporary spatial closure implemented to reduce bycatch of the Australian Sea Lion. Catches of the Port Jackson Shark within the GHAT are therefore likely to have reduced compared to the 1970s. Although 100% of the Port Jackson Shark catches are reportedly discarded (Walkeret al.2005, Walker and Gason 2007), fishers were known to persecute the species resulting in poor post-release survival rate. This practice is believe to have ceased (T. Walker, pers. comm., February 2015).

In South Australia, the Port Jackson Shark is caught as bycatch in the Spencer Gulf and Gulf St Vincent Prawn Trawl Fishery (Currieet al.2009, SARDI unpublished data) and was caught in 73 of the 120 sites sampled during a bycatch survey of the Spencer Gulf Prawn Trawl Fishery (Currieet al.2009).

In Western Australia, the Port Jackson Shark is the major non-retained bycatch of theTemperate Demersal Gillnet and Demersal Longline Fishery (TDGDLF) and theAbrolhos Islands and Mid West Trawl Fishery (Fletcher and Santoro 2013), in which the species accounted for 75% (by estimated weight) of all observed elasmobranch discards during the late 1990s, and accounted for 10.3% of the total elasmobranch catch (McAuley and Simpfendorfer 2003, Bensley et al. 2010). A survey of commercial catches from trawl, gillnet, and longline fisheries showed that the Port Jackson Shark was one of the four most abundant bycatch elasmobranch species (Joneset al.2010). Specifically, it was the fifth, second, and fifth most frequently caught elasmobranch, representing 7.5, 19.9, and 5.4% of the elasmobranch catches in the trawl, gillnet, and longline fishery, respectively. The size composition of the catch varied across fishing gear, with the trawl fishery catching smaller individuals (mostly 20-40 cm TL) than the gillnet (mostly 50-110 cm TL) or the longline (mostly 55-100 cm TL) fisheries. Observations on catches of demersal gillnet fishers in southern Western Australia have indicated that stocks remain relatively healthy, with large catches regularly made after 20 years of intensive fishing (C. Simpfendorfer, pers. comm., February 2015).

Although the Port Jackson Shark is a large bycatch component of several fisheries across its range, post-release stress studies have shown that the species is very resilient to capture stress from gillnet, trawl,and longline gear (Fricket al.2009, Fricket al. 2010a, 2010b, Bracciniet al.2012), suggesting that this species is likely to have high post-release survival rates from a range of fishing methods.

In Western Australia, reported catches of the Port Jackson Shark for marine aquaria ranged from 197 to 664 specimens per year between 2008 and 2012 (Fletcher and Santoro 2013).

Recreational fishers occasionally catch the Port Jackson Shark, but it is not specifically targeted because of its low flesh quality. A survey of recreational boat anglers on the lower west coast of Western Australia estimated that the recreational catch by this sector of the recreational fishery was 273 individuals in the period from September 1996 to August 1997 (Sumner and Williamson 1999), while the estimated annual catch during 201112 by recreational fishing from boat licence holders was 2,200 (Ryan et al. 2013). These levels of catch are very minor when compared to commercial catches.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The only specific management regulation that exists for the Port Jackson Shark is the recreational fishing trip catch limit for sharks imposed by Western Australia (four of any species). No other states have bag or size limits that cover this species. However,site attached species such as the Port Jackson Shark may also benefit from habitat protection and suitably designed and implemented no-take zones, where all forms of harvesting or fishing are excluded.Commercial collectors of live specimens for the aquarium trade are normally licensed by state governmental legislation.Large commercial aquaria are able to successfully breed the species in captivity, reducing the reliance on wild caught animals.The occurrence of this species close inshore offers refuge from some larger commercial fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Port Jackson sharks are considered harmless to people.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Port Jackson sharks are important members of healthy marine ecosystems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Port Jackson shark

The Port Jackson shark (Heterodontus portusjacksoni) is a nocturnal, oviparous (egg laying) type of bullhead shark of the family Heterodontidae, found in the coastal region of southern Australia, including the waters off Port Jackson. It has a large, blunt head with prominent forehead ridges and dark brown harness-like markings on a lighter grey-brown body, and can grow up to 1.67 metres (5.5 ft) long.[1]

The Port Jackson shark is a migratory species, traveling south in the summer and returning north to breed in the winter months. It feeds on hard-shelled mollusks, crustaceans, sea urchins, and fish. Identification of this species is very easy due to the pattern of harness-like markings which cross the eyes, run along the back to the first dorsal fin, then cross the side of the body, in addition to the spine in front of both dorsal fins.

Distribution and habitat[edit]

The Port Jackson shark is endemic to the temperate waters around southern Australia and can be found in an area stretching from southern Queensland, south to Tasmania, and west to the central coast of Western Australia. There are dubious reports of catchings as far north as Western Australia's York Sound and, on one occasion, it has occurred off the coast of New Zealand. Genetic studies suggest there may be two Australian groups, one found from Northeastern Victoria to Western Australia and the second found from Southern Queensland to New South Wales. The species is believed to have originated somewhere off the coast of South Africa.[2] It usually lives less than 100 metres (330 ft) of water, but has been known to go as deep as 275 metres (902 ft).[3]

The shark's territory is habitually sited on, or near, the sea bottom, which is also its feeding area.[4] Rocky environments are the most common habitat, though sandy and muddy ones, as well as seagrass beds, are sometimes used.[3] During the day, when it is usually not active, it can be found in flat areas which offer some shelter from currents (including caves)[5] or near other sheltering positions such as rocky outcrops.

Appearance[edit]

Port Jackson sharks are similar to others of their genus, bearing a broad, blunt, flat head, an anal fin, and crests above its eyes. However, the species possesses characteristics that make them easily identifiable, such as their teeth and the harness-like markings which run for a majority of their body length. These markings runs from their eyes to their first dorsal fin and then across the rest of their body. Both of its dorsal fins are of close to equal size, each with a spine at the foremost edge. These spines are rumored to be poisonous.[3] Other features that help distinguish them are their small mouths as well as their nostrils, which are connected to their mouth.[5]

The sharks have gray-brown bodies covered by black banding, which covers a large portion of their sides and back. One of these band winds over the face and progresses even to the shark's eyes. Another harness shaped band goes around the back, continuing until the pectoral fins and sides. Thin dark stripes are also present on the back of Port Jackson sharks. These progress from the caudal fin to the first dorsal fin.[5]

Two Port Jackson Sharks, demonstrating "harness" feature.

Teeth[edit]

The teeth of the Port Jackson shark are one of its most distinguishable feature. Unlike other sharks, its teeth are different in the front and back. The frontal teeth are small, sharp and pointed, while the latter is flat and blunt. These teeth function to hold and break, then crush and grind the shells of the mollusks and echinoderms that this species feeds upon. Juveniles of the species have teeth that are sharper and their diet has a higher proportion of soft-bodied prey than adults.[3]

Mouth of a Port Jackson shark showing teeth and crushing plate

Respiratory system[edit]

The Port Jackson shark has five gills, the first supports only a single row of gill filaments, while the remaining four support double rows of filaments. Each of the second to the fifth gill arches supports a sheet of muscular and connective tissue called a septum. The shark possesses behind each eye an accessory respiratory organ called a spiracle. Along the top and bottom of each gill filament are delicate, closely packed, transverse flaps of gill tissue known as secondary lamellae. It is these lamellae that are the actual sites of gas exchange. Each lamella is equipped with tiny arteries that carry blood in a direction opposite to that of the water flowing over them. To compensate for the relatively low concentration of dissolved oxygen in seawater, water passes over the secondary lamellae of sharks some 20 times more slowly than air remains in contact with the equivalent gas exchange sites, such as the alveoli of the lungs found in humans. This delay allows sufficient time for dissolved oxygen to diffuse into a shark's blood.

Port Jackson sharks have the ability to eat and breathe at the same time. This ability is unusual for sharks which mostly need to swim with the mouth open to force water over the gills. The Port Jackson shark can pump water into the first enlarged gill slit and out through the other four gill slits. By pumping water across the gills, the shark does not need to move to breathe. It can lie on the bottom for long periods of time.

Reproduction[edit]

Male Port Jackson sharks become sexually mature between ages 8 and 10, and females at 11 through 14. They are oviparous, meaning that they lay eggs rather than give live birth to their young. The species has an annual breeding cycle which begins in late August and continues until the middle of November. During this time the female lays pairs of eggs every 10 to 14 days. As many as 8 pairs can be laid during this period. The eggs mature for 10–11 months before the hatchlings, known as neonates, can break out of the egg capsule. The eggs have been assessed in recent studies as having an 89.1% mortality rate, mostly from predation.[5]

Digestive system[edit]

Digestion of food can take a long time in the Port Jackson shark. Food moves from the mouth to the 'J' shaped stomach, where it is stored and initial digestion occurs. Unwanted items may never get any further than the stomach, and are coughed up again. They have the ability to turn their stomachs inside out and spit it out of their mouths in order to get rid of any unwanted contents. One of the biggest differences in digestion in the shark when compared to mammals is the extremely short intestine. This short length is achieved by the spiral valve with multiple turns within a single short section instead of a very long tube-like intestine. The valve provides a very long surface area for the digestion of food, requiring it to pass around inside the apparently short gut until fully digested, when remaining waste products pass by. The most obvious internal organ in sharks is the huge liver, which often fills most of the body cavity. Dietary items include sea urchins, molluscs, crustaceans and fishes. Black sea urchins (Centrostephanus rodgersii) are often eaten. Port Jackson Sharks forage for food at night when their prey are most active. They often use caves and rocky outcrops as protection during the day. When most people think of shark teeth, they think of large, sharp teeth like those in the film 'Jaws'. Not all sharks have teeth like these. The teeth of the Port Jackson Shark are very different. They are not serrated, and the front teeth have a very different shape from those found at the back of the jaws, hence the genus name Heterodontus (from the Greek heteros, meaning 'different', and dont, meaning 'tooth'). The anterior teeth are small and pointed, whereas the posterior teeth are broad and flat. The teeth function to hold and break, then crush and grind the shells of molluscs and echinoderms. Juvenile Port Jackson Sharks have more pointed teeth and feed on a higher proportion of soft-bodied prey than adults. They can feed by sucking in water and sand from the bottom, blowing the sand out of the gill slits, and retaining the food, which is swallowed.

Relationship with humans[edit]

The shark has no major importance to humans. It is not an endangered species and is not utilized as a common food supply. It is, however, useful when scientists are hoping to study bottom-dweller sharks and can be vulnerable to being caught as bycatch. It also does not pose any danger to humans.[5] In October 2011 a man was 'bitten' by a Port Jackson shark at Elwood Beach near Melbourne. The bite did not pierce the skin and the man was able to swim away while the shark was latched on to his calf.[6]

Conservation[edit]

Although listed as "Least Concern" on the World Conservation Union (IUCN) Red List, it is known that the shark's egg capsules experience very high mortality rates (estimated at 89.1%). Its status is otherwise largely unknown. Predators of the species are also unknown. Though Crested bullhead shark (Heterodontus galeatus) are known to prey upon Port Jackson shark embryos, the biggest threat is probably from other sharks such as white sharks and the broadnose sevengill shark (Notorynchus cepedianus).[5]

Gallery[edit]

References[edit]

  1. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5.  Check date values in: |date= (help)
  2. ^ Burton, p. 2027.
  3. ^ a b c d M. McGrouther (October 2006). "Port Jackson Shark". Australian Museum. Retrieved March 26, 2009. 
  4. ^ Dianne J. Bray, 2011, Port Jackson Shark, Heterodontus portusjacksoni, in Fishes of Australia, accessed 26 Aug 2014, http://www.fishesofaustralia.net.au/home/species/1982
  5. ^ a b c d e f Rebecca Sarah Thaler. "Port Jackson Shark". Florida Museum of Natural History. Retrieved March 27, 2009. 
  6. ^ "Man bitten by shark at Elwood beach". 

Bibliography[edit]

  • Robert Burton (2002). International Wildlife Encyclopedia. Marshall Cavendish. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!