Overview

Comprehensive Description

Biology

A moderately common benthic and epibenthic shark found on the continental shelf (Ref. 247, 43278). Occurs from close inshore to about 93 m depth (Ref. 247, 43278). Feeds primarily on sea urchins, but also on crustaceans, mollusks, and small fishes (Ref. 31369). Oviparous, egg cases spirally flanged and with long tendrils (Ref. 6871). Hatches at about 22 cm (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Heterodontus galeatus is endemic to the western Pacific Ocean in warm temperate waters along the east coast of Australia ranging from Cape Moreton in southern Queensland south to Batemans Bay in New South Wales (Last and Stevens 1994, Johnson 1999). Whitley (1940) reports an egg case from Moa Island in the Torres Strait, but this northern Queensland record may be doubtful (J. Johnson pers. comm).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: eastern Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1520 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

152 cm TL (male/unsexed; (Ref. 247)); max. reported age: 12 years (Ref. 72467)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body with broad blackish bands or saddle markings (Ref. 9838).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

A moderately common benthic and epibenthic shark of the southern Australian continental shelf at moderate depths, ranging from close inshore in the intertidal zone to 93 m. Found on reefs, in kelp and in beds of seagrass.
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Heterodontus galeatus is considered to be less common than the sympatric Port Jackson shark, Heterodontus portusjacksoni, which is found throughout most of the range of H. galeatus. However, H. galeatus tends to replace H. portusjacksoni in northern New South Wales (NSW) and southern Queensland with the centre of its distribution in warmer waters than H. portusjacksoni (Whitley 1940, McLaughlin 1969). McLaughlin (1969) when assessing the heterodontid sharks of the central NSW coast wrote that H. galeatus is "difficult to find underwater and was rarely encountered by fishermen, indicting that its local density was probably much lower than that of H. portusjacksoni" (McLaughlin 1969, page 9). This species is recorded from the intertidal zone to 93 m on the continental shelf (Whitley 1940, Michael 1993, Last and Stevens 1994). Its bathymetric distribution is largely unknown but some speculate that it may be more common in deeper waters than close inshore (Kuiter 1993, Jeff Johnson, personal communication). The species is found around rocky reefs, among large macroalgae and on seagrass beds (Michael 1993). Heterodontus galeatus does not appear to form large aggregations as displayed by H. portusjacksoni. Individuals of both H. galeatus and H. portusjacksoni can be observed together occupying the same habitat (David Powter, pers. comm.).

This species is nocturnal and feeds on a variety of benthic and epibenthic prey including echinoids (largest component of diet), crustaceans, molluscs and small fish (Last and Stevens 1994). McLaughlin (1969) examined the gut contents of four mature animals of which the bulk of contents consisted of the echinoids, Centrostephanus rodgersii and Heliocardis erythrogramma. This diet appears similar to that of H. portusjacksoni, however, McLaughlin (1969) suggests that H. galeatus may display greater specialisation on the two echinoid species. These sharks are known to extend their heads between rocks in search of prey items (Michael 1993). Heterodontus galeatus has been observed feeding on a H. portusjacksoni egg case (David Powter, pers. comm.).

Various maximum sizes of H. galeatus have been reported. Stead (1963, page 19) states that "as a general rule it [H. galeatus] is found of a somewhat smaller size than the common Port Jackson shark [H. portusjacksoni] of similar age". Heterodontus portusjacksoni is reported to grow to a maximum of 165 cm total length (TL) but is "normally much smaller" (Last and Stevens 1994, page 113). Whitley (1940) reported a total length (TL) of 120 cm for H. galeatus. Last and Stevens (1994) report the species attaining 130 cm TL. The Fishbase database provides a larger maximum size of 152 cm TL (Froese and Pauly 2002), Michael (1993) reports 150 cm TL and observations on the NSW central coast suggest a maximum size of at least 150 cm TL (David Powter, pers. comm).

Last and Stevens (1994) report that females mature at 70 cm TL and males at 60 cm TL. However, there have been recent observations of two males from southern Queensland of 53.5 and 56 cm TL, which were sexually mature, based on the state of their secondary sexual organs following the assessment of maturity as outlined by Bass et al. (1974) (unpublished data). The reported size of maturity for females may be based on a single captive individual hatched and held at the Taronga Park Aquarium, Sydney, Australia (Whitley 1950). This individual is reported to have matured in its eleventh year of age, based on the first time it laid eggs in captivity (Whitley 1950). Females lay spiral-shaped egg cases (about 11 cm long) that have long tendrils at their apices (tendrils reported up to 2 m in length), providing attachment to seaweed or sponges (Waite 1896, Michael 1993, Last and Stevens 1994). Oviposition is reported to take place during July and August in depths of 20 to 30 m (McLaughlin 1969, Last and Stevens 1994). Michael (1993) reports egg-laying in depths of 15 m or more, also during late winter, but states that oviposition can occur all year around. There are also reports of egg cases attached to sponges in waters as shallow as 8.6 m (David Powter, pers. comm.). Heterodontus galeatus generally lays in deeper water than H. portusjacksoni, which mostly lays in less than 5 m (McLaughlin and O’Gower 1971). Young are reported to hatch at about 22 cm TL (Last and Stevens 1994). The individual hatched in captivity at the Taronga Park Aquarium was reported at a smaller size of about 17 cm TL (Jacups 1943, Whitley 1950).

There are minimal reports on the egg-laying rate and hence annual fecundity of the species. McLaughlin (1969) examined one mature female (77.5 cm TL) in June, and found it to be consistent with an estimated fecundity for H. portusjacksoni of 10-16 eggs per year. Reproductive periodicity has not been documented, however, given that concentrations of eggs are reported seasonally during late winter, it is suggested that the species breeds annually. Furthermore, H. portusjacksoni displays an annual reproductive cycle (McLaughlin and O’Gower 1971) implying that H. galeatus may be similar. Whitley (1940) suggested a gestation period of at least five months while others (Jacups 1943; Whitley 1950; Last and Stevens 1994) report a longer period of 8-9 months. This latter figure may be based on the one captive individual held at the Taronga Park Aquarium. There is no information available on age and growth in wild H. galeatus; however, limited information is available from captivity. Jacups (1943) and Whitley (1950) report a growth rate of 5 cm per year for the captive Taronga Park female. It is thought that the species is relatively long-lived given its apparent protracted immaturity (Whitley 1950).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 93 m (Ref. 54545)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 93m.
Recorded at 93 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A moderately common benthic and epibenthic shark found on the continental shelf . Occurs from close inshore to about 93 m depth. Feeds primarily on sea urchins, but also on crustaceans, mollusks, and small fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heterodontus galeatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATATTTGATCTTTGGTGCATGAGCTGGAATAGTAGGGACGGCTTTAAGTTTACTTATCCGAGCTGAATTAAGCCAGCCTGGATCTCTCTTAGGCGATGACCAAATCTATAATGTTATTGTAACTGCCCATGCTTTTGTAATAATCTTTTTTATAGTTATACCTGTAATGATTGGAGGGTTTGGCAATTGACTTGTTCCATTAATAATCGGTGCCCCCGATATAGCCTTCCCACGAATAAATAACATAAGCTTTTGACTTCTTCCACCCTCATTTCTTTTGCTCCTGGCTTCAGCTGGAGTTGAAGCAGGGGCTGGAACTGGCTGAACAGTTTACCCCCCTTTAGCTGGCAATCTAGCCCATGCCGGAGCATCCGTAGACCTAGCAATCTTCTCCTTACACTTAGCTGGTATTTCATCAATCTTAGCCTCAATCAACTTTATTACAACCATTATTAACATAAAACCCCCAGCTATCTCCCAATACCAAACGCCCTTGTTTGTTTGATCAATCCTTGTAACCACCGTCCTCCTTTTACTTTCACTTCCTGTTTTAGCAGCTGGAATTACGATGCTACTAACCGACCGTAATCTAAACACAACATTCTTTGATCCTGCTGGCGGAGGAGATCCTATTCTATACCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Heterodontus galeatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Kyne, P.M. & Bennett, M.B. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Fowler, S. & Cavanagh, R.D. (Shark Red List Authority)

Contributor/s

Justification
An uncommon heterodontid shark restricted to relatively shallow water (0 to 93 m) and endemic to the eastern Australian states of Queensland and New South Wales. It is considered rare, particularly when compared with the sympatric Heterodontus portusjacksoni. Little information is available on its life history. The species is not targeted commercially, and incidental capture, recreational fishing and protective beach meshing programs are not significantly impacting. Post-capture survivorship appears high. Although rare there are no current threats to the species. However, given this apparent rarity, further research and close monitoring of catches is necessary.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No information available on populations.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is not targeted or marketed commercially (Last and Stevens 1994, Nick Otway, personal communication). Recreational fishing is thought to have little impact on the species because of its apparent rarity in inshore waters. Spearfishers are more likely to encounter H. portusjacksoni on inshore reefs, and they are known to take this species for sport. Line fishers may encounter H. galeatus on rare occasions. The species is caught as bycatch in various commercial fisheries operating in NSW and southern Queensland waters. The species is taken as bycatch in demersal prawn trawl fisheries in NSW (Ocean Prawn Trawl Fishery) and in Queensland (eastern king prawn sector of the East Coast Trawl Fishery). The NSW ocean trap and line fishery is also likely to capture this species, however numbers taken as bycatch are not known as there is no distinction in the recording of the two species of heterodontid in fisheries statistics (H. galeatus and H. portusjacksoni) (Nick Otway, pers. comm). Heterodontus spp. captured as bycatch in this fishery are normally released alive (Nick Otway, pers. comm.).

Protective beach meshing programs operate in NSW and Queensland waters and are likely to capture H. galeatus. Numbers caught in Queensland are not available while catches in the NSW Protective Beach Meshing Program are not divisional between the two heterodontid species (Nick Otway, pers. comm). Between October 1972 and December 1990, 435 Port Jackson sharks were caught in this program, equating to a catch rate of 0.394 sharks/km of net/year (Krogh 1994) (these figures are considered as underestimates). Krogh (1994) notes that H. portusjacksoni, being the more common species, is more likely to constitute the larger portion of the catch. Reid and Krogh (1992) provide information on net mortality for Heterodontus spp. caught in the program. Of 60 individuals sampled, 96.7% were alive in the net, the highest survival rate of the 11 species or species groups sampled. Non-dangerous sharks are released by contractors servicing the protective nets whenever practical (Reid and Krogh 1992). Given this survivorship, and if animals are successfully released alive, then beach meshing may not be having a significant impact on Heterodontus spp. Similarly, if animals are successfully released alive from prawn trawlers, then these activities may also be having minimal impact. However, information on post-release mortality is unavailable and therefore catches need to be classified to species level and catch rates monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Heterodontus galeatus is listed as a Declared Animal in Schedule 3 of the Queensland Marine Parks (Moreton Bay) Zoning Plan 1997. This schedule declares species that could be affected by over-exploitation. This declaration limits the collecting of H. galeatus in the Moreton Bay Marine Park, a Marine Protected Area (MPA) of approximately 306,000 hectares. However, records of the species inside Moreton Bay, and therefore in the majority of the area of the MPA, are rare (Johnson 1999), the species usually occurring in offshore regions. Under Schedule 3, collection of H. galeatus requires a permit.

The species is also likely to occur in a number of MPAs in NSW waters, however recreational line and spear fishing are permitted in many of these. Marine Protected Areas in NSW waters where H. galeatus is likely to occur and where commercial and recreational fishing activities are completely banned in at least some sections of the park are: Solitary Islands Marine Park (71,000 hectares), Jervis Bay Marine Park (21,450 hectares), Cabbage Tree Bay Aquatic Reserve (Sydney, 17 hectares), Bushrangers Bay Aquatic Reserve (Shell Harbour, three hectares) and Shiprock Aquatic Reserve (Port Hacking, two hectares). Zoning plans for these parks are complex and ‘no-take’ zones only exist in small areas. There is also a proposal for a Marine Park in the Byron Bay region, northern NSW. Additionally, H. galeatus is likely to occur in the Commonwealth managed Solitary Islands Marine Reserve (17,000 hectares) adjacent to NSW’s Solitary Islands Marine Park.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
  • Compagno, L.J.V. and V.H. Niem 1998 Squatinidae. Angelsharks, sand devils. p. 1235-1238. In K.E. Carpenter and V.H. Niem (eds.) FAO Identification Guide for Fishery Purposes. The Living Marine Resources of the Western Central Pacific. FAO, Rome.   http://www.fishbase.org/references/FBRefSummary.php?id=31369 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Crested bullhead shark

The crested bullhead shark (Heterodontus galeatus) is an uncommon species of bullhead shark, in the family Heterodontidae. It lives off the coast of eastern Australia from the coast to a depth of 93 m (305 ft). This shark can be distinguished from other members of its family by the large size of the ridges above its eyes and by its color pattern of large dark blotches. It typically attains a length of 1.2 m (3.9 ft).

Nocturnal and bottom-dwelling, the crested bullhead shark favors rocky reefs and vegetated areas, where it hunts for sea urchins and other small organisms. It is oviparous, with females producing auger-shaped egg capsules that are secured to seaweed or sponges with long tendrils. Sexual maturation is slow, with one female in captivity not laying eggs until almost 12 years of age. The International Union for Conservation of Nature (IUCN) has assessed this harmless shark as of Least Concern; it is of no economic interest and suffers minimal mortality from bycatch, recreational fishing, and shark nets.

Taxonomy[edit]

British zoologist Albert Günther originally described the crested bullhead shark as Cestracion galeatus in the 1870 eighth volume of Catalogue of the Fishes in the British Museum. He chose the specific epithet galeatus from the Latin for "helmeted", referring to the prominent ridges above the shark's eyes that also give it its common name.[2][3]

Subsequent authors moved this species to the genera Gyropleurodus and Molochophrys before placing it in Heterodontus. The type specimen is a 68 cm (27 in) long female caught off Australia.[2] This shark may also be referred to as crested shark, crested bull shark, crested horn shark, and crested Port Jackson shark.[4]

Description[edit]

The high ridges above the eyes of the crested bullhead shark are its most distinctive feature.

The head of the crested bullhead shark is short and wide, with a blunt, pig-like snout. The eyes are placed high on the head and lack nictitating membranes. The supraorbital ridges above the eyes of this species are larger than any other member of its family. The nostrils are separated into incurrent and excurrent openings by a long flap of skin that reaches the mouth. A furrow encircles the incurrent opening and another furrow runs from the excurrent opening to the mouth, which is located nearly at the tip of the snout. The teeth at the front of the jaws are small and pointed with a central cusp and two lateral cusplets, while those at the back of the jaws are wide and molar-like. There are deep furrows at the corners of the mouth, extending onto both jaws.[2]

The pectoral fins are large and rounded, while the pelvic and anal fins are smaller and more angular. The first dorsal fin is moderately tall with a rounded to angular apex and a stout spine on the leading margin, originating behind the pectoral fins. The second dorsal fin resembles the first and is almost as large, and is located between the pelvic and anal fins. The caudal fin is broad, with a strong ventral notch near the tip of the upper lobe. The dermal denticles are large and rough, especially on the flanks. The coloration consists of five brown to black, diffusely edged saddles on a light tan background. There are dark marks on top of the head between the crests and below each eye. Most crested bullhead sharks measure no more than 1.2 m (4 ft) long, but a few may reach 1.5 m (5 ft).[2]

Distribution and habitat[edit]

The crested bullhead shark is found on or near the bottom.

The range of the crested bullhead shark is restricted to the warm temperate waters along the eastern coast of Australia, from Cape Moreton, Queensland to Batemans Bay, New South Wales. There are also dubious records of this species from off Cape York Peninsula in the north and Tasmania in the south. This species co-occurs with the related Port Jackson shark (H. portusjacksoni) across much of its range, but is generally much rarer except off southern Queensland and northern New South Wales, where it tends to replace the other species.[1]

Bottom-dwelling in nature, the crested bullhead shark is found over the continental shelf from the intertidal zone to a depth of 93 m (305 ft), being more common in deeper waters. It prefers rocky reefs, mats of seaweed, and seagrass beds.[1]

Biology and ecology[edit]

A crested bullhead shark feeding on an egg of the Port Jackson shark.

The crested bullhead shark is a slow-moving, nocturnal species often seen wedging its head between rocks in search of food. It feeds primarily on the sea urchins Centrostephanus rodgersii and Heliocidaris erythrogramma, but has also been known to take a variety of other invertebrates and small fishes.[1] A steady diet of sea urchins may stain the teeth of this shark pinkish purple.[5] The crested bullhead shark is also a major predator of the eggs of the Port Jackson shark, which are seasonally available and rich in nutrients. Individual sharks have been observed taking the egg capsules in their mouths and chewing on the tough casing, rupturing it and allowing the contents to be sucked out; egg capsules may also be swallowed whole.[6] Unlike the Port Jackson shark, the crested bullhead shark is not known to form large aggregations.[1]

The egg case of the crested bullhead shark has distinctive long tendrils at one end.

Crested bullhead sharks are oviparous with a possibly annual reproductive cycle. Females produce 10–16 eggs per year during late winter in July and August, though Michael (1993) noted that egg laying may continue year-round.[1] The egg cases measure around 11 cm (4.3 in) in length, with a pair of thin flanges spiraling 6–7 times around the outside and two slender tendrils up to 2 m (6.6 ft) long at one end, used to attach the capsule to seaweed or sponges.[1][2] The capsules are usually deposited at a depth of 20–30 m (66–98 ft), much deeper than the Port Jackson shark, though there is a single record of an egg being found only 8.6 m (28 ft) down. The time to hatching has been variously reported as 5 and 8–9 months; the newly emerged young measure 17–22 cm (6.7–8.7 in) long and resemble the adults. Last and Stevens (1994) gave the lengths at maturity for males and females at 60 cm (24 in) and 70 cm (28 in) respectively, though mature males as small as 53.5 cm (21.1 in) long were later found off Queensland. Growth and aging has been documented for one captive female at the Taronga Park Aquarium, which grew an average of 5 cm (2.0 in) per year and did not lay eggs until she was almost 12 years old.[1]

Human interactions[edit]

Inoffensive towards humans, the crested bullhead shark is of little interest to recreational or commercial fisheries. It is seldom caught on hook-and-line, but is sometimes targeted by spear fishers. Commercial bottom trawl prawn fisheries operating off Queensland and New South Wales take this species as bycatch; the impact of these activities on the population is uncertain as this species is not recorded separately from the Port Jackson shark. However, most bullhead sharks caught in these fisheries survive to be released alive. Crested bullhead sharks are likely also caught in mesh shark nets used to protect beaches; again, most are able to survive the experience. Because of the limited mortality suffered by this species from various human activities, the International Union for Conservation of Nature (IUCN) has assessed this species as of Least Concern, albeit also recommending that it be carefully monitored given its restricted distribution and overall uncommonness. The range of the crested bullhead shark overlaps with several Marine Protected Areas (MPAs); additionally it was listed as a Declared Animal in Schedule 3 of the 1997 Queensland Marine Parks (Moreton Bay) Zoning Plan, which regulates its collection in Moreton Bay Marine Park.[1]

References[edit]

  1. ^ a b c d e f g h i Kyne, P.M. and M.B. Bennett (2003). Heterodontus galeatus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved October 29, 2009.
  2. ^ a b c d e Compagno, L.J.V. (2002). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date (Volume 2). Rome: Food and Agriculture Organization. pp. 38–39. ISBN 92-5-104543-7. 
  3. ^ Günther, A.C.L.G. (1870). Catalogue of the Fishes in the British Museum, Volume 8. The Trustees. p. 416. 
  4. ^ Froese, Rainer and Pauly, Daniel, eds. (2009). "Heterodontus galeatus" in FishBase. October 2009 version.
  5. ^ Huxley, T.H. (1883). Fish Diseases. W. Clowes and Sons. p. 15. 
  6. ^ Powter, D.W. and W. Gladstone (2008). "Embryonic mortality and predation on egg capsules of the Port Jackson shark Heterodontus portusjacksoni (Meyer)". Journal of Fish Biology 72 (3): 573–584. doi:10.1111/j.1095-8649.2007.01721.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!