Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs along exposed reef margins and outer reef slopes. Has been observed at depth of 183 m in Hawaii (Ref. 1602). Benthopelagic (Ref. 58302). Secretive during the day and hides in holes and crevices of surge channels. Feeds at night on crustaceans, crustacean larvae, polychaete worms, and small fishes. Spine of preopercle venomous.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Madagascar, Seychelles and Mascarenes east to Hawaiian Islands and Pitcairn Group, north to southern Japan and Ogasawara Islands, south to Western Australia at 21°40'S, Queensland (Australia) at 15°50'S, New Caledonia, Tonga, and Austra
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to the Hawaiian, Marquesan, and Ducie islands, north to southern Japan, south to Australia and the Austral Islands; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 15; Analspines: 4; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 330 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

33.0 cm TL (male/unsexed; (Ref. 4201))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Occurs along exposed reef margins and outer reef slopes. Has been observed at depth of 183 m in Hawaii (Ref. 1602). Secretive during the day and hides in holes and crevices of surge channels. Feeds at night on crustaceans, crustacean larvae, polychaete worms, and small fishes. Spine of preopercle venomous.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body is red with silvery red stripes overlaid with blue iridescence; spinous portion of dorsal fin red with white-tipped spines and a white blotch in the middle of each membrane; leading edges of pelvic and anal spines white (Ref. 2334). Five oblique scale rows on cheek; body depth 2.6-2.95 in SL; head length (HL) 2.6-2.9 in SL; snout often shorter than orbit diameter, its length 3.6-3.9 in HL; interorbital width 5.05-5.85 in HL; maxilla extending posteriorly from center of eye to below rear edge of the pupil, upper jaw length 2.2-2.3 in HL; premaxillary groove usually reaching to a vertical at front edge of the orbit; anterior end of nasal bone with 2 short diverging spines; medial margin of nasal bone spineless; large nasal fossa without spinules on margin; slight ridge along the upper edge of suborbital bones with low recumbent spinules in young, becoming smooth in adults, at least below the anterior half of orbit; opercle with 2 large subequal opercular spines; preopercular spine, 3.6-5.2 in HL; short dorsal spines, 3rd to 5th subequal, 4th dorsal spine usually longest, 2.6-3.5 in HL; 3rd anal spine 1.5-2.3 in HL (Ref. 27370).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Sargocentron tiere
Catalog Number: USNM 153565
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): N. Pike
Year Collected: 1871
Locality: Mauritius, Mascarene Islands, Indian
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 1 - 183m.
From 1 to 183 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 183 m (Ref. 9710), usually 1 - 20 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 90 specimens in 1 taxon.
Water temperature and chemistry ranges based on 86 samples.

Environmental ranges
  Depth range (m): 0.305 - 35
  Temperature range (°C): 25.245 - 29.336
  Nitrate (umol/L): 0.019 - 0.382
  Salinity (PPS): 34.080 - 36.148
  Oxygen (ml/l): 4.444 - 4.823
  Phosphate (umol/l): 0.083 - 0.301
  Silicate (umol/l): 0.897 - 3.666

Graphical representation

Depth range (m): 0.305 - 35

Temperature range (°C): 25.245 - 29.336

Nitrate (umol/L): 0.019 - 0.382

Salinity (PPS): 34.080 - 36.148

Oxygen (ml/l): 4.444 - 4.823

Phosphate (umol/l): 0.083 - 0.301

Silicate (umol/l): 0.897 - 3.666
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534). A nocturnal species (Ref. 75154).
  • Parrish, J.D., J.E. Norris, M.W. Callahan, J.K. Callahan, E.J. Magarifuji and R.E. Schroeder 1986 Piscivory in a coral reef fish community. p. 285-297. In C.A. Simenstad and G.M. Cailliet (eds.) Contemporary studies on fish feeding. Dr. W. Junk Publishers, Dordrecht, The Netherlands. (Ref. 2763)   http://www.fishbase.org/references/FBRefSummary.php?id=2763&speccode=4908 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sargocentron tiere

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Sargocentron tiere

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGTACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCTGGAGCTCTCCTGGGAGACGACCAGATTTATAATGTCATTGTTACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAACTGACTAATCCCCCTAATGATTGGAGCCCCTGATATAGCATTCCCTCGGATAAATAACATAAGCTTCTGACTATTACCCCCATCATTCCTTCTTCTACTAGCCTCTTCCGGAGTAGAAGCTGGTGCCGGGACAGGATGAACAGTATACCCACCCCTTGCAGGTAATTTAGCCCACGCAGGGGCTTCTGTTGACCTTACTATTTTCTCACTCCATCTAGCAGGTATTTCTTCAATTCTTGGGGCCATTAATTTTATTACAACTATTATTAACATAAAACCCCCTGCCATTTCCCAATACCAAACTCCCCTGTTTGTATGAGCCGTTCTCATTACAGCTGTCCTTCTACTTCTATCCCTGCCCGTGCTCGCAGCAGGAATTACCATGCTGCTGACAGACCGAAACCTAAACACAACATTCTTCGACCCAGCAGGAGGTGGAGATCCGATCCTTTACCAACACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sargocentron tiere

Sargocentron tiere or the blue-lined squirrelfish is one species of Squirrelfish from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 33 cm in length.

Distribution[edit]

This fish is found around the Hawaiian Islands. Its habitat is reef margins and outer reef slopes.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!