Overview

Comprehensive Description

Biology

Benthic (Ref. 58302). Found on lower slope, continental rise and oceanic ridges. Solitary. Perches on substrate with the aid of specialized fin rays (tripod), facing the current. Feeds on nektonic copepods and other small planktonic crustaceans. Synchronously hermaphroditic (Ref. 6688).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Mexico, Madagascar, Mozambique, North West Atlantic, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: scattered records in the Mediterranean, off Cape Blanc in Mauritania, Azores, Gulf of Guinea and off equatorial Africa. Western Atlantic: USA to Gulf of Mexico including Caribbean and along Rio Grande Rise. Western Indian Ocean: Mozambique Channel. Elsewhere, equatorial western Pacific (Ref. 3590) and eastern Pacific (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

39.1°N to Gulf of Mexico including Caribbean and along Rio Grande Rise
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through temperate seas, including Mediterranean Sea, Hawaiian Islands, but except southeastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 368 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

36.8 cm SL (male/unsexed; (Ref. 3590))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Elongate pelvic and caudal fin rays held body above the sediment. These rays appeared flexible when the fishes swam and stiff when they were perched on the bottom (Ref. 7460).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found on lower slope, continental rise and oceanic ridges. Solitary. Perches on substrate with the aid of specialized finrays (tripod), facing the current. Feeds on nektonic copepods and other small planktonic crustaceans. Synchronously hermaphroditic (Ref. 6688).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Cotype for Bathypterois grallator
Catalog Number: USNM 35651
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, New Jersey, United States, Atlantic
Depth (m): 2811 to 2811
Vessel: Albatross
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Bathypterois grallator
Catalog Number: USNM 44675
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1885
Locality: New Jersey, United States, Atlantic
Depth (m): 2480
Vessel: Albatross
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; marine; depth range 878 - 4720 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found on lower slope, continental rise and oceanic ridges. Solitary. Perches on substrate with the aid of specialized finrays (tripod), facing the current.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 2085 - 4851
  Temperature range (°C): 1.407 - 3.703
  Nitrate (umol/L): 17.733 - 34.097
  Salinity (PPS): 34.725 - 35.008
  Oxygen (ml/l): 3.991 - 6.139
  Phosphate (umol/l): 1.146 - 2.470
  Silicate (umol/l): 13.402 - 133.420

Graphical representation

Depth range (m): 2085 - 4851

Temperature range (°C): 1.407 - 3.703

Nitrate (umol/L): 17.733 - 34.097

Salinity (PPS): 34.725 - 35.008

Oxygen (ml/l): 3.991 - 6.139

Phosphate (umol/l): 1.146 - 2.470

Silicate (umol/l): 13.402 - 133.420
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 878 - 3492m.
From 878 to 3492 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on lower slope, continental rise and oceanic ridges. Solitary. Perches on substrate with the aid of specialized finrays (tripod), facing the current. Feeds on nektonic copepods and other small planktonic crustaceans.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Classification

In family Chlorophthalmidae in Fishbase 96
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathypterois grallator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGCCTTCTTATTCGGGCAGAACTAAGTCAACCAGGAGCCCTCTTGGGTGAT---GACCAAATTTATAATGTAATTGTTACCGCACATGCTTTTGTAATAATCTTCTTTATGGTTATACCAATTATAATCGGAGGATTCGGAAATTGACTGATCCCCCTTATG---ATCGGGGCCCCAGACATAGCATTTCCACGGATAAATAACATAAGCTTCTGACTCCTTCCCCCTTCTTTTCTCCTTCTTCTATCTTCATCCGGGGTAGAAGCTGGGGCCGGAACCGGTTGAACTGTTTACCCTCCCCTAGCCAGCAACCTCGCACACGCCGGGGCTTCTGTAGACTTA---ACTATTTTTTCTCTTCATTTGGCAGGAATTTCATCAATCTTAGGGGCCATCAATTTTATTACAACTATTATTAACATGAAACCCCCAGGCATTTCCCAGTATCAAACCCCCCTATTCGTTTGATCAGTTCTAATTACAGCTGTTCTCCTTCTCCTTTCCCTTCCCGTTCTAGCAGCG---GGGATTACCATGCTATTGACAGACCGAAATTTAAATACCACTTTCTTCGACCCTGCAGGGGGGGGTGACCCCATTCTTTATCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTTTACATTTTAATTCTTCCGGGGTTCGGAATGATTTCTCACATCGTAGCATACTATTCAGGTAAAAAA---GAACCTTTCGGGTACATAGGAATGGTCTGAGCCATGATAGCCATTGGCCTCCTCGGTTTCATTGTGTGAGCCCACCAAATGTTCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bathypterois grallator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tripod fish

Tripod fish, Bathypterois grallator, are a deep-sea benthic fish found at lower latitudes. They are now relatively well known from photographs and submersible observations. They seem to prefer to perch on the ooze using much elongated fin rays in their tails and two pelvic fins in order to stand, facing upstream with the pectoral fins turned forward so that the outthrust projecting fin rays resemble multiple antennae, and are indeed used as tactile organs. Bathypterois grallator are hermaphroditic. There are at least eighteen species in the genus Bathypterois, several of which have similar appearance and behavior to Bathypterois grallator.

Contents

Characteristics [edit]

The tripod fish has long, bony rays that stick out below its tail fin and both pectoral (chest) fins. Even though the fish’s body is 36 centimeters (14 inches) long, its fins can be more than a meter (3.3 feet). Most of the time, the tripod fish stands on its three fins on the bottom of the ocean. Even though the fins are presumably quite stiff, researchers have been successful in surprising the fish into swimming, and then the fins seem flexible. It spends much of its adult life standing on the sea floor hunting its food.[1]

Habitat [edit]

Bathypterois grallator has been found relatively widely throughout the ocean from a northern latitude of the 40th parallel north to a southern latitude of the 40th parallel south. It is a wide ranging eurybathic fish and it is found from 878 to 4720 meters (2854 to 15,340 feet) deep.[1] Along with the giant squid, deep-sea anglerfish and black swallower, it is one of the permanent residents found in the Abyssal zone and was directly observed on the historic voyage of the bathyscaphe Trieste to the Mariana Trench.

Food [edit]

The tripod fish uses tactile and mechanosensory cues to identify food; the tripod fish apparently does not have special visual adaptations to help them find food in their low-light environment. When the fish is perched with its long rays on the ocean floor, it can get dinner without even seeing its meal. The tripod fish’s mouth ends up at just the right height to catch shrimp, tiny fish and small crustaceans swimming by. They seem to prefer to perch on the mud using much elongated fin rays in their tails and two pelvic fins in order to stand, facing upstream into the current to ambush with the pectoral fins turned forward so that the outthrust projecting fins resemble multiple antennae. The fish senses objects in the water with its front fins. These fins act like hands. Once they feel prey and realize it is edible, the fins knock the food into the fish’s mouth.[2] The fish faces into the current, waiting for prey to drift by.[3]

Reproduction [edit]

Each individual has male and female reproductive organs. If two tripod fish happen to meet, they mate. However, if a tripod fish does not find a partner, it makes both sperm and eggs to produce offspring by itself.[4]

Related and similar species [edit]

There are at least eighteen species included in the genus Bathypterois. Similar species are often observed in the same areas. A 2001 report included observations of Bathypterois dubius as far as 50 degrees north latitude in the Bay of Biscay.[5]

There is a striking parallel between some ice fishes and the tripod fishes. Marshall drew attention to the similarities between tripod fish and one of the ice fish, Pagetopsis, which was described by Robilliard and Dayton as perching on a sponge. The stance of Chionodraco is an even more striking parallel. Both ice fishes and the tripod fish use a similar strategy of sitting motionless above the substrate with the attendant benefits that motionlessness brings to a nonvisual, particularly mechanosensory, function.

The tripod fish is closely related to the spider fish Bathypterois longifilis, which is similar in appearances and habits but is smaller and has much shorter fin extensions. They are often found standing very close to each other.[2] The family to which both fish belong, Inopidae, is called the family of tripod fishes or spiderfishes interchangeably.

References [edit]

  1. ^ a b Jones, AT; KJ Sulak (1990). "First Central Pacific Plate and Hawaiian Record of the Deep-sea Tripod Fish Bathypterois grallator (Pisces: Chlorophthalmidae)" (PDF). Pacific Science 44 (3): 254–7. 
  2. ^ a b Hoar, W.S.; Randall, D.J., Conte, F.P. (1997). Deep-Sea Fishes. Fish Physiology 16. Academic Press. p. 344. ISBN 0-12-350440-6. 
  3. ^ Hyde, N. Deep Sea Extremes. Crabtree Publishing Company, 2009. ISBN 0-7787-4501-5, p. 16; Winner, C. Life on the Edge. Lerner Publications, 2006. ISBN 0-8225-2499-6, p. 18; Gage, J.D., Tyler, P. A. Deep-sea biology: a natural history of organisms at the deep-sea floor. Cambridge University Press. 1992. ISBN 0-521-33665-1, p. 86
  4. ^ Winner, C. Life on the Edge. Lerner Publications, 2006. ISBN 0-8225-2499-6, p. 18
  5. ^ Trenkel VM, et al. First results of a quantitative study of deep-sea fish on the continental slope of the Bay of Biscay: visual observations and trawling. ICES CM 2001/L:18
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!