Overview

Comprehensive Description

Biology

Benthic (Ref. 58302). Found on lower slope, continental rise and oceanic ridges. Solitary. Perches on substrate with the aid of specialized fin rays (tripod), facing the current. Feeds on nektonic copepods and other small planktonic crustaceans. Synchronously hermaphroditic (Ref. 6688).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

39.1°N to Gulf of Mexico including Caribbean and along Rio Grande Rise
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: scattered records in the Mediterranean, off Cape Blanc in Mauritania, Azores, Gulf of Guinea and off equatorial Africa. Western Atlantic: USA to Gulf of Mexico including Caribbean and along Rio Grande Rise. Western Indian Ocean: Mozambique Channel. Elsewhere, equatorial western Pacific (Ref. 3590) and eastern Pacific (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical through temperate seas, including Mediterranean Sea, Hawaiian Islands, but except southeastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 368 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

36.8 cm SL (male/unsexed; (Ref. 3590))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found on lower slope, continental rise and oceanic ridges. Solitary. Perches on substrate with the aid of specialized finrays (tripod), facing the current. Feeds on nektonic copepods and other small planktonic crustaceans. Synchronously hermaphroditic (Ref. 6688).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Elongate pelvic and caudal fin rays held body above the sediment. These rays appeared flexible when the fishes swam and stiff when they were perched on the bottom (Ref. 7460).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Cotype for Bathypterois grallator
Catalog Number: USNM 35651
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1884
Locality: Cape Hatteras To Nantucket, New Jersey, United States, Atlantic
Depth (m): 2811 to 2811
Vessel: Albatross
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Bathypterois grallator
Catalog Number: USNM 44675
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1885
Locality: New Jersey, United States, Atlantic
Depth (m): 2480
Vessel: Albatross
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found on lower slope, continental rise and oceanic ridges. Solitary. Perches on substrate with the aid of specialized finrays (tripod), facing the current.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 878 - 4720 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 2085 - 4851
  Temperature range (°C): 1.407 - 3.703
  Nitrate (umol/L): 17.733 - 34.097
  Salinity (PPS): 34.725 - 35.008
  Oxygen (ml/l): 3.991 - 6.139
  Phosphate (umol/l): 1.146 - 2.470
  Silicate (umol/l): 13.402 - 133.420

Graphical representation

Depth range (m): 2085 - 4851

Temperature range (°C): 1.407 - 3.703

Nitrate (umol/L): 17.733 - 34.097

Salinity (PPS): 34.725 - 35.008

Oxygen (ml/l): 3.991 - 6.139

Phosphate (umol/l): 1.146 - 2.470

Silicate (umol/l): 13.402 - 133.420
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 878 - 3492m.
From 878 to 3492 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on lower slope, continental rise and oceanic ridges. Solitary. Perches on substrate with the aid of specialized finrays (tripod), facing the current. Feeds on nektonic copepods and other small planktonic crustaceans.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on copepods and other small crustaceans
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Classification

In family Chlorophthalmidae in Fishbase 96
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathypterois grallator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AGCCTTCTTATTCGGGCAGAACTAAGTCAACCAGGAGCCCTCTTGGGTGAT---GACCAAATTTATAATGTAATTGTTACCGCACATGCTTTTGTAATAATCTTCTTTATGGTTATACCAATTATAATCGGAGGATTCGGAAATTGACTGATCCCCCTTATG---ATCGGGGCCCCAGACATAGCATTTCCACGGATAAATAACATAAGCTTCTGACTCCTTCCCCCTTCTTTTCTCCTTCTTCTATCTTCATCCGGGGTAGAAGCTGGGGCCGGAACCGGTTGAACTGTTTACCCTCCCCTAGCCAGCAACCTCGCACACGCCGGGGCTTCTGTAGACTTA---ACTATTTTTTCTCTTCATTTGGCAGGAATTTCATCAATCTTAGGGGCCATCAATTTTATTACAACTATTATTAACATGAAACCCCCAGGCATTTCCCAGTATCAAACCCCCCTATTCGTTTGATCAGTTCTAATTACAGCTGTTCTCCTTCTCCTTTCCCTTCCCGTTCTAGCAGCG---GGGATTACCATGCTATTGACAGACCGAAATTTAAATACCACTTTCTTCGACCCTGCAGGGGGGGGTGACCCCATTCTTTATCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTTTACATTTTAATTCTTCCGGGGTTCGGAATGATTTCTCACATCGTAGCATACTATTCAGGTAAAAAA---GAACCTTTCGGGTACATAGGAATGGTCTGAGCCATGATAGCCATTGGCCTCCTCGGTTTCATTGTGTGAGCCCACCAAATGTTCAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathypterois grallator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bathypterois grallator

The tripodfish or tripod spiderfish, Bathypterois grallator, is a deep-sea benthic fish in the Ipnopidae family found at lower latitudes. It is now relatively well known from photographs and submersible observations, and seem to prefer to perch on the ooze using much elongated fin rays in the tail and two pelvic fins to stand, facing upstream with the pectoral fins turned forward so the outthrust projecting fin rays resemble multiple antennae, and are indeed used as tactile organs. B. grallator is hermaphroditic. At least 18 species are placed in the genus Bathypterois, several of which have similar appearance and behavior to B. grallator. Like a lot of deep-sea creatures, they tend to grow larger than most shallow-water fish. This benthic fish grows to be 3 ft (0.91 m) long and 4 ft (1.2 m) tall (counting their tripod-like fins).

Characteristics[edit]

The tripodfish has long, bony rays that stick out below its tail fin and both pectoral (chest) fins. The fish’s body is 36 cm (14 in), but its fins can be more than 1 m (3 ft 3 in). Most of the time, the tripodfish stands on its three fins on the bottom of the ocean, hunting for food.[1] Even though the fins are presumably quite stiff, researchers have been successful in surprising the fish into swimming, and then the fins seem flexible.

Habitat[edit]

Bathypterois grallator has been found relatively widely in the Atlantic, Pacific, and Indian oceans from 40°N to 40°S. It is a wide-ranging eurybathic fish found from 878 to 4,720 m (2,881 to 15,486 ft) deep.[1] Along with the giant squid, deep-sea anglerfish, and black swallower, it is one of the permanent residents found in the abyssal zone and was directly observed on the historic voyage of the bathyscaphe Trieste to the Mariana Trench.

Food[edit]

The tripodfish uses tactile and mechanosensory cues to identify food; it apparently does not have special visual adaptations to help it find food in the low-light environment. When the fish is perched with its long rays on the ocean floor, it can get food without even seeing it. The tripodfish’s mouth ends up at just the right height to catch shrimp, tiny fish, and small crustaceans swimming by. They seem to prefer to perch on the mud using much elongated fin rays in their tails and two pelvic fins to stand, facing upstream into the current to ambush with the pectoral fins turned forward so the outthrust projecting fins resemble multiple antennae. The fish senses objects in the water with its front fins. These fins act like hands. Once they feel prey and realize it is edible, the fins knock the food into the fish’s mouth.[2] The fish faces into the current, waiting for prey to drift by.[3]

Reproduction[edit]

Each individual has male and female reproductive organs. If two tripodfish happen to meet, they mate. However, if a tripodfish does not find a partner, it makes both sperm and eggs to produce offspring by itself.[4]

Related and similar species[edit]

At least 18 species included in the genus Bathypterois. Similar species are often observed in the same areas. A 2001 report included observations of Bathypterois dubius as far as 50°N in the Bay of Biscay.[5]

A striking parallel exists between some icefishes and the tripodfishes. The stance of Chionodraco is an even more striking parallel. Both icefishes and the tripodfish use a similar strategy of sitting motionless above the substrate with the attendant benefits that motionlessness brings to a nonvisual, particularly mechanosensory, function.

The tripodfish is closely related to the spider fish Bathypterois longifilis, which is similar in appearances and habits but is smaller and has much shorter fin extensions. They are often found standing very close to each other.[2] The family to which both fish belong, Inopidae, is called the family of tripod fishes or spiderfishes interchangeably.

References[edit]

  1. ^ a b Jones, AT; KJ Sulak (1990). "First Central Pacific Plate and Hawaiian Record of the Deep-sea Tripod Fish Bathypterois grallator (Pisces: Chlorophthalmidae)" (PDF). Pacific Science 44 (3): 254–7. 
  2. ^ a b Hoar, W.S.; Randall, D.J.; Conte, F.P. (1997). Deep-Sea Fishes. Fish Physiology 16. Academic Press. p. 344. ISBN 0-12-350440-6. 
  3. ^ Hyde, N. Deep Sea Extremes. Crabtree Publishing Company, 2009. ISBN 0-7787-4501-5, p. 16; Winner, C. Life on the Edge. Lerner Publications, 2006. ISBN 0-8225-2499-6, p. 18; Gage, J.D., Tyler, P. A. Deep-sea biology: a natural history of organisms at the deep-sea floor. Cambridge University Press. 1992. ISBN 0-521-33665-1, p. 86
  4. ^ Winner, C. Life on the Edge. Lerner Publications, 2006. ISBN 0-8225-2499-6, p. 18
  5. ^ Trenkel VM, et al. First results of a quantitative study of deep-sea fish on the continental slope of the Bay of Biscay: visual observations and trawling. ICES CM 2001/L:18
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!