Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: butterflyfish (English), mariposa (Espanol)
 
Chaetodon kleinii Bloch, 1790


Klein's butterflyfish,     Sunburst butterflyfish

Body a strongly compressed oval disc; mouth small, at end of a short (~ eye), pointed snout; teeth long and slender; dorsal fin with XIII-XIV, 22-23; anal fin III, 21-22, 2nd  spine longer than 3rd; rear edges of dorsal and anal fins bluntly angular; tail edge straight to rounded; scales rough, covering dorsal and anal fins as well as head and body; lateral line in a high arch, incomplete (ends under dorsal fin);  33-41 lateral line scales.



Front half white, rear ½ of body and fins yellow-tan; a dark bar from forehead through eye to chest, blue above eye, black below; a broad tan bar behind pectoral.

Size: 15 cm.

Habitat: rocky and coral reefs.


Depth: 3-60 m.

Indo-Pacific; a vagrant in the Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Occur in deeper lagoons and channels, and seaward reefs (Ref. 1602). Benthopelagic (Ref. 58302). Depth 2-61 m, usually below 10 m (Ref. 90102). Occur singly or in pairs (Ref. 37816). Common, omnivorous individuals that feed mainly on soft coral polyps (mainly on Sarcophyton tracheliophorum and Litophyton viridis), algae and zooplankton. Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed throughout most of the Indo-Pacific region, from coastal East Africa to central and western Pacific, including the Hawaiian Islands and Rapa Iti to the east, extending northwards to southern Japan and south to Lord Howe Island (Australia). Vagrants are occasionally seen in the eastern Pacific and at the Galapagos Islands (Ecuador) (G.R. Allen pers. comm. 2006). Occurs at depths from 2-61 m but usually below 10 m.

Range size ~66.2 million km2, from values estimated by Jones et al. (2002) based on projection of distribution maps from Allen et al. (1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 3 (S) - 60 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa (south to Coffee Bay, South Africa, Ref. 5372) to the Hawaiian Islands and Samoa, north to southern Japan, south to New South Wales, Australia and New Caledonia. Eastern Pacific: Galapagos Islands (Ref. 5227).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Hawaiian Islands, Line Islands and Marquesas Islands, north to southern Japan, south to Kimberleys (Western Australia), Lord Howe Island, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 15.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 20 - 23; Analspines: 3; Analsoft rays: 17 - 20; Vertebrae: 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 5372))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in deeper lagoons and channels, and seaward reefs to a depth of 61 m (Ref. 1602). Common, omnivorus butterflyfish that feeds mainly on soft coral polyps (mainly on @Sarcophyton tracheiliophorum@ and @Litophyton viridis@), algae and zooplankton. The color changes little as it matures-the mark above the eye becomes bright blue to almost luminous.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body is yellowish brown with two broad white vertical bars running across the body one from near the origin of the dorsal spine and the other from the middle of the back. A black bar runs vertically across the eye. There are numerous dotted horizontal stripes on the sides. The margin of caudal fin is transparent (Ref. 4855). Snout length 2.5-3.2 in HL. Body depth 1.5-1.8 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Chaetodon corallicola
Catalog Number: USNM 50880
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Penguin Bank, South coast of Oahu Island, Diamond Head Light, N. 19 degrees, W. 20.0 miles [nautical]., Oahu, Hawaii, United States, Hawaiian Archipelago, Pacific
Depth (m): 49 to 53
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cotype for Chaetodon corallicola
Catalog Number: USNM 55317
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1902
Locality: Penguin Bank, South coast of Oahu Island, Diamond Head Light, N. 20 degrees, W. 18.0 miles [nautical]., Oahu, Hawaii, United States, Hawaiian Archipelago, Pacific
Depth (m): 49 to 51
Vessel: Albatross
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Chaetodon corallicola
Catalog Number: USNM 50880
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): United States Fish Commission (USFC)
Year Collected: 1902
Locality: Penguin Bank, South coast of Oahu Island, Diamond Head Light, N. 19 degrees, W. 20.0 miles [nautical]., Oahu, Hawaii, United States, Hawaiian Archipelago, Pacific
Depth (m): 49 to 53
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cotype for Chaetodon corallicola
Catalog Number: USNM 55317
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): United States Fish Commission (USFC)
Year Collected: 1902
Locality: Penguin Bank, South coast of Oahu Island, Diamond Head Light, N. 20 degrees, W. 18.0 miles [nautical]., Oahu, Hawaii, United States, Hawaiian Archipelago, Pacific
Depth (m): 49 to 51
Vessel: Albatross
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is associated with rocky reefs and coral-rich areas (sometimes interspersed with sandy bottoms) of lagoons, channels and outer reef slopes. Occurs singly, in pairs, or occasionally in larger aggregations of up to about 30 individuals (Myers 1991), sometimes high in the water column. It is a facultative corallivore, feeding on hard and soft corals, as well as algae, hydroids and zooplankton.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 141 specimens in 1 taxon.
Water temperature and chemistry ranges based on 101 samples.

Environmental ranges
  Depth range (m): 0.15 - 100
  Temperature range (°C): 23.154 - 29.205
  Nitrate (umol/L): 0.016 - 1.522
  Salinity (PPS): 33.797 - 35.395
  Oxygen (ml/l): 4.406 - 4.871
  Phosphate (umol/l): 0.055 - 0.284
  Silicate (umol/l): 0.869 - 4.892

Graphical representation

Depth range (m): 0.15 - 100

Temperature range (°C): 23.154 - 29.205

Nitrate (umol/L): 0.016 - 1.522

Salinity (PPS): 33.797 - 35.395

Oxygen (ml/l): 4.406 - 4.871

Phosphate (umol/l): 0.055 - 0.284

Silicate (umol/l): 0.869 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 4 - 61 m (Ref. 9710), usually 10 - ? m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 141 specimens in 1 taxon.
Water temperature and chemistry ranges based on 101 samples.

Environmental ranges
  Depth range (m): 0.15 - 100
  Temperature range (°C): 23.154 - 29.205
  Nitrate (umol/L): 0.016 - 1.522
  Salinity (PPS): 33.797 - 35.395
  Oxygen (ml/l): 4.406 - 4.871
  Phosphate (umol/l): 0.055 - 0.284
  Silicate (umol/l): 0.869 - 4.892

Graphical representation

Depth range (m): 0.15 - 100

Temperature range (°C): 23.154 - 29.205

Nitrate (umol/L): 0.016 - 1.522

Salinity (PPS): 33.797 - 35.395

Oxygen (ml/l): 4.406 - 4.871

Phosphate (umol/l): 0.055 - 0.284

Silicate (umol/l): 0.869 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 61m.
From 4 to 61 meters.

Habitat: reef-associated. Occurs in deeper lagoons and channels, and seaward reefs (Ref. 1602). Common, omnivorus species that feeds mainly on soft coral polyps (mainly on @Sarcophyton tracheiliophorum@ and @Litophyton viridis@), algae and zooplankton.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Omnivore

Diet: benthic microalgae, soft corals/hydroids, zooplankton, pelagic fish eggs, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occur in deeper lagoons and channels, and seaward reefs (Ref. 1602). Occur singly or in pairs (Ref. 37816). Common, omnivorous individuals that feed mainly on soft coral polyps (mainly on Sarcophyton tracheliophorum and Litophyton viridis), algae and zooplankton. Feed on plants, benthic and planktonic invertebrates (Ref. 6110, 13550).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon kleinii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACTGCCTTAAGCCTCCTCATCCGAGCAGAGCTCAGTCAACCAGGCACCCTTCTAGGCGACGACCAAATTTATAATGTCATCGTCACGGCGCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTAATTCCTCTAATGATTGGTGCTCCCGACATGGCTTTCCCTCGAATAAACAACATGAGCTTTTGACTCCTGCCCCCTTCTTTCTTCCTCCTGCTTGCCTCGTCTGGCGTAGAGTCCGGGGCTGGAACAGGATGAACCGTCTACCCCCCACTGGCGGGCAACCTGGCCCACGCCGGAGCATCAGTTGATTTAACCATCTTCTCCCTACACCTTGCGGGGATTTCATCTATTCTTGGGGCTATTAACTTCATCACAACAATTCTTAACATGAAACCGCCTGCGATGTCTCAGTATCAGACCCCCCTGTTCGTATGATCTGTTCTAATTACAGCTGTCCTCCTTCTTCTGTCTCTACCTGTCCTTGCGGCCGGTATTACAATGCTTCTAACGGACCGAAACCTAAACACAACCTTCTTTGATCCAGCAGGAGGAGGAGACCCTATTTTATACCAGCATCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon kleinii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L.A., Pyle, R., Myers, R., Craig, M.T. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, large population and no apparent major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is generally common with stable populations (G.R. Allen pers. comm. 2006). It is common in New Guinea and Queensland (Australia) (Steene 1978). This species was not observed during a recent survey conducted at the Galapagos Archipelago (Edgar et al. 2004).

Common species: mean of 0.87 individuals per 200 m2 in northern Great Barrier Reef (Pratchett and Berumen 2008).


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There appear to be no species-specific conservation measures in place. This species is present within a number of marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sunburst butterflyfish

The Sunburst Butterflyfish is also known as the Black-lipped Butterflyfish (or "blacklip butterflyfish") or Klein's Butterflyfish. Its scientific name is Chaetodon kleinii.

It is a native of the Indo-Pacific region, from the Red Sea and East Africa to the Hawaiian Islands and Samoa, north to southern Japan, south to Australia and New Caledonia. It is also found in Galapagos Islands in the Eastern Pacific.[2]

Under its junior synonym C. corallicola was placed in the monotypic subgenus Tifia, but this cannot be separated from the earlier-described Lepidochaetodon (sometimes considered a separate genus). It appears to be closer to the Tahiti Butterflyfish (C. trichrous) than to the Teardrop Butterflyfish (C. unimaculatus).[3]

Description and ecology[edit source | edit]

The body of this fish is yellowish brown with 1-2 broad lighter vertical bars, one running from near the origin of the dorsal spine to the belly, and sometimes another running from the middle of the back to the center of the body. A black bar runs vertically across the eye, and the part before this is whitish, with a black snout. The color varies somewhat across the range; western specimens usually have one beige bar, while eastern ones have two white bars. There may be numerous dotted horizontal stripes on the sides, or another dark band between the two light ones in eastern specimens.[2]

In the wild, the Sunburst Butterflyfish is found at depths of 4–61 meters, usually in deeper lagoons and channels and seaward reefs, swimming singly, or (particularly during breeding) in pairs. These fish are oviparous.[2]

They are omnivores, feeding mainly on soft coral polyps (especially Litophyton viridis and Sarcophyton tracheliophorum), algae and zooplankton. In the aquarium, Chaetodon kleinii will eat meaty food such as mysis. Its coral-eating habits can become a nuisance, but on the other hand they are fond of Aiptasia, small sea anemones that often become a pest in seawater aquaria.[4]

Footnotes[edit source | edit]

  1. ^ Rocha, L.A., Pyle, R., Myers, R., Craig, M.T. & Pratchett, M. 2010. Chaetodon kleinii. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 10 September 2013.
  2. ^ a b c FishBase (2008)
  3. ^ Fessler & Westneat (2007), Hsu et al. (2007)
  4. ^ FishBase (2008), PetEducation.com [2008]

References[edit source | edit]

  • Fessler, Jennifer L. & Westneat, Mark W. (2007): Molecular phylogenetics of the butterflyfishes (Chaetodontidae): Taxonomy and biogeography of a global coral reef fish family. Mol. Phylogenet. Evol. 45(1): 50–68. doi:10.1016/j.ympev.2007.05.018 (HTML abstract)
  • FishBase (2008): Chaetodon kleinii. Version of 2008-JAN-14. Retrieved 2008-SEP-01.
  • Hsu, Kui-Ching; Chen, Jeng-Ping & Shao, Kwang-Tsao (2007): Molecular phylogeny of Chaetodon (Teleostei: Chaetodontidae) in the Indo-West Pacific: evolution in geminate species pairs and species groups. Raffles Bulletin of Zoology Supplement 14: 77-86. PDF fulltext
  • PetEducation.com [2008]: Klein's Butterflyfish. Retrieved 2008-SEP-01.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!