Overview

Comprehensive Description

Biology

Found on sand bottom (Ref. 2850), usually in deep water (Ref. 9988). Feeds on invertebrates and bottom fishes (Ref. 6885). Livers of large individuals are a rich source of vitamin A (Ref. 6885). Marketed fresh or as frozen fillets (Ref. 2850). Eaten steamed, fried, micro-waved and baked (Ref. 9988). Generally regarded as the premium Pacific coast sole (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Bering Sea coast of Alaska to Islas Los Coronados, northern Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found from the Aleutian Islands and the Bering Sea coast of Alaska to Islas Los Coronados, northern Baja California, Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 87 - 101; Analspines: 0; Analsoft rays: 67 - 79; Vertebrae: 41 - 44
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

53.0 cm TL (male/unsexed; (Ref. 56527)); 70 cm TL (female); max. published weight: 3,700 g (Ref. 56527); max. reported age: 25 years (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dorsal origin over middle part of eye. Caudal longest in middle, ending in a broad 'V'. Pectoral fins large, bluntly pointed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 0 - 550 m (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Adults inhabits sandy and muddy substrates at depths of 80 to 550 m on the continental shelf and slope. As juveniles, the diet consists of small invertebrates, while the adults feed on fishes including herring and small pollock, shrimp and crabs. Spawning occurs during November to March, depending on the particular spawning ground. Females spawn once a year and fecundity is related to fish size. This species has a pelagic larval stage (J.G. Nielsen pers. comm. 2009).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1216 specimens in 1 taxon.
Water temperature and chemistry ranges based on 726 samples.

Environmental ranges
  Depth range (m): 0.91 - 421.5
  Temperature range (°C): 5.424 - 9.443
  Nitrate (umol/L): 9.687 - 37.822
  Salinity (PPS): 32.340 - 34.190
  Oxygen (ml/l): 1.139 - 5.667
  Phosphate (umol/l): 1.098 - 2.880
  Silicate (umol/l): 13.552 - 70.929

Graphical representation

Depth range (m): 0.91 - 421.5

Temperature range (°C): 5.424 - 9.443

Nitrate (umol/L): 9.687 - 37.822

Salinity (PPS): 32.340 - 34.190

Oxygen (ml/l): 1.139 - 5.667

Phosphate (umol/l): 1.098 - 2.880

Silicate (umol/l): 13.552 - 70.929
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 550m.
Recorded at 550 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on benthic invertebrates and demersal fish (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eopsetta jordani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACAGGCCTAAGTCTGCTTATTCGAGCAGAACTAAGCCAACCCGGGGCTCTCCTAGGGGACGACCAAATTTATAACGTGATCGTCACCGCACACGCCTTTGTAATAATCTTTTTTATAGTAATACCCATTATGATCGGAGGGTTCGGAAACTGGCTTATCCCACTAATGATCGGAGCCCCAGACATGGCATTCCCTCGAATAAATAATATGAGTTTCTGACTTCTACCCCCCTCCTTCCTTCTTCTCTTAGCCTCTTCAGGTGTCGAAGCCGGGGCGGGAACGGGCTGAACCGTCTACCCCCCACTGGCTGGCAATCTAGCCCACGCCGGAGCATCCGTAGACCTCACAATTTTCTCCCTCCACCTTGCAGGTATTTCATCAATCCTCGGGGCAATTAACTTCATTACCACTATCATCAACATGAAACCCATAGCAGTTACTATGTACCAAATTCCATTATTTGTTTGAGCCGTTCTAATCACGGCCGTCCTTCTTCTTCTCTCCCTCCCCGTCTTAGCCGCAGGAATTACCATGCTGCTAACAGACCGCAACCTAAACACGACTTTCTTTGACCCCTCCGGTGGAGGAGACCCCATCCTGTATCAGCACCTATTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eopsetta jordani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Munroe, T.A. & Nielsen, J.G.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Eopsetta jordani has been assessed as Least Concern. Despite harvesting by the commercial fishing industry and natural fluctuations in population numbers, there is no evidence to suggest that this species qualifies for a threat category. At present the stocks are in recovery from some record low levels of abundance. Continued monitoring of the population numbers and harvest levels of this species is needed to ensure that current measures to aid stock recovery are sufficient to rebuild the population of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Ten separate breeding stocks have been identified for this species, however mixing of the stocks can occur outside of the spawning season. The stocks in British Columbia were considered to be at low levels by the late 20th century (Fargo and Kronlund 1997). Consequently, annual landings were capped at 479 tonnes (t) in 1997, limiting trawl fishers to incidental harvests only. The proportion of small sized individuals entering the fishery had increased over the period of 1998-2002 (Starr and Fargo 2004). Starr and Fargo (2004) found that the population has been increasing in abundance in recent years and current stock status seems to be at or above the level of maximum yield. Recently an increase of by-catch rates of this species have been recorded by fishermen.

In the USA, this species is not considered to be overfished (Lai et al. 2005). Stocks in the areas between Vancouver and Columbia (Northern region) and areas south of Columbia (Southern region), reached historical lows in 1992 and 1986 respectively (Lai et al. 2005). However, regional populations of this species can experience periods of low levels of abundance due to adverse environmental conditions. Furthermore, stocks in both regions have increased rapidly in recent years (Lai et al. 2005). In 2005, the estimated spawning biomass of this species was 4960 t for the Northern region and 4667 t for the Southern region.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is an important commercial food fish, and has been fished throughout its range since the 19th century by bottom trawlers. A substantial portion of the annual harvest is taken from spawning grounds during winter months (November to February). Catches for the USA ranged from approximately 1,400-2,600 t over the period 1981-2004. In Canada, annual landings were capped at 479 t in 1997, limiting trawl fishers to incidental harvests only.

Stocks off both the USA and Canada are said to have increased in recent years (Starr and Fargo 2004; Lai et al. 2005). Recently an increase of by-catch rates of this species have been recorded by fishermen off British Columbia (Starr and Fargo 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Harvesting for this species is carried out under stock management regulations. These regulations are applicable throughout much of this species range. In British Columbia, trawls have been limited to incidental catches only, due to low stock levels.

Monitoring of the population trends of this species is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Petrale sole

The Petrale sole, Eopsetta jordani, is an edible flatfish of the family Pleuronectidae. It is a demersal fish that lives on sandy bottoms, usually in deep water, down to depths of about 550 metres (1,800 ft). Males can grow to 53 centimetres (21 in) in length, females to 70 centimetres (28 in), and they can weigh up to 3.7 kilograms (8.2 lb). Its native habitat is the Eastern Pacific, stretching from the coast of Baja California in the south to the Aleutian Islands in the Bering Sea in the north.[2][3]

Petrale sole is an important commercial fish, caught all along the West Coast of the United States and Canada and into the Bering Sea, almost exclusively by trawler.[3][4][5]

Contents

Identification

Petrale sole is a right-eyed flounder with an oval body. Its upper surface is uniformly light to dark brown, and its lower surface is white, sometimes with pink traces. It has a large mouth with two rows of small, arrow-shaped teeth on the upper jaw and one row of teeth on the lower jaw.[5]

Diet

Juvenile petrale sole feed on cumaceans, carideans and amphipods, whilst adults will eat shrimps, crabs, epibenthos organisms and other fish, such as herring, hake, anchovy, pollock and other flatfish.[3]

Commercial Fishing

The Petrale sole is an important commercial fish, and has been fished off Oregon since at least 1884. One fishery exists, off the west coast of the United States; although petral sole are native to Alaska and are caught there and in other fisheries, no other designated petrale sole fishery exists.[3][5]

Between 1995 and 2004 the coastwide catch of petrale sole ranged from 1,616 to 2,377 tonnes. The Pacific Fishery Management Council has established Acceptable Biological Catch limits for the annual harvests of petrale sole in the waters off the US west coast; from 1995 to 2000 the coastwide total annual catch did not exceed the catch limit, but from 2001 the catch in the Northern assessment area has exceeded the portion of the catch limit attributed to that area.[3][4]

The estimated biomass of petrale sole in the northern segment of the fishery reached a historical low of 1,267 tonnes in 1992, but has increased steadily since then to 4,960 tonnes in 2005. The southern segment reached a historical low of 1,012 tonnes in 1986, and, after remaining stable for ten years, by 2005 it had increased to 4,667 tonnes. Petrale sole is currently not designated as overfished.[3]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!