Overview

Comprehensive Description

Biology

Found on mud bottoms (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: Japan to the Gulf of Alaska and to Mexican border.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 109 - 117; Analspines: 0; Analsoft rays: 95 - 98
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 470 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

47.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dorsal origin over posterior edge of pupil. Caudal imperfectly rounded. Pectorals short.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 41 - 1800 m (Ref. 50610), usually 500 - 950 m (Ref. 57945)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 170 specimens in 1 taxon.
Water temperature and chemistry ranges based on 149 samples.

Environmental ranges
  Depth range (m): 195.76 - 50000
  Temperature range (°C): 2.364 - 6.429
  Nitrate (umol/L): 37.073 - 44.916
  Salinity (PPS): 34.090 - 34.538
  Oxygen (ml/l): 0.303 - 1.240
  Phosphate (umol/l): 2.962 - 3.485
  Silicate (umol/l): 67.806 - 160.825

Graphical representation

Depth range (m): 195.76 - 50000

Temperature range (°C): 2.364 - 6.429

Nitrate (umol/L): 37.073 - 44.916

Salinity (PPS): 34.090 - 34.538

Oxygen (ml/l): 0.303 - 1.240

Phosphate (umol/l): 2.962 - 3.485

Silicate (umol/l): 67.806 - 160.825
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 320 - 1433m.
From 320 to 1433 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Embassichthys bathybius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGCACAGGCTTAAGTCTGCTTATTCGAGCAGAACTAAGCCAACCTGGGGCTCTCCTAGGAGACGATCAAATTTATAACGTAATCGTCACCGCACACGCCTTTGTAATAATCTTTTTTATGGTAATACCCATTATGATTGGAGGATTCGGAAACTGACTTATCCCCTTAATAATCGGGGCCCCTGACATAGCCTTCCCCCGAATAAATAATATGAGTTTCTGACTTCTCCCCCCGTCCTTTCTACTCCTCTTAGCCTCTTCAGGTGTTGAGGCAGGGGCAGGTACGGGGTGAACAGTATACCCTCCGCTAGCGGGCAATCTAGCCCACGCCGGAGCATCCGTAGACCTGACAATCTTCTCACTACACCTCGCAGGTGTCTCCTCAATCCTGGGGGCTATTAACTTTATTACCACCATTATTAACATAAAACCCGCAACAGTTACCATGTATCAAATCCCCTTATTTGTCTGAGCTGTTCTAATCACTGCTGTTCTTCTACTCCTATCACTACCCGTCTTAGCGGCTGGCATTACGATGCTACTAACAGACCGAAACCTAAACACAACATTCTTTGATCCTGCCGGAGGGGGCGACCCCATCCTCTATCAACACCTGTTCTGATTCTTCGGC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Embassichthys bathybius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Deepsea sole

The deepsea sole, Embassichthys bathybius, is a flatfish of the family Pleuronectidae. It is a bathydemersal fish that lives on muddy bottoms at depths of between 41 and 1,800 metres (135 and 5,906 ft), though it is most often found at depths of 500 to 950 metres (1,640 to 3,120 ft). Its native habitat is the northern Pacific, from Japan to the Gulf of Alaska and down the Pacific coasts of Canada and the USA as far south as Mexico. It grows up to 47 centimetres (19 in) in length.[1]

References[edit]

  1. ^ Froese, Ranier; Pauly, Daniel, eds. (5 June 2009). "Embassichthys bathybius". Fishbase. Retrieved 2009-06-30. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!