Overview

Comprehensive Description

Description

  Common names: sleeper (English), puyequi (Espanol), dormilón (Espanol)
 
Dormitator latifrons (Richardson, 1844)


Pacific fat sleeper


Head and body somewhat compressed, body relatively deep, deepest before dorsal fin; head broad and flat on top; eyes on side of head snout blunt; gill membranes broadly joined to throat; mouth oblique, top jaw reaching to level of front of eye; teeth small conical, in several rows on jaws; two separate dorsal fins, VII weak spines + I, 8-9, base of 2nd  dorsal < distance from the end of that base to tail fin; anal rays I, 9-10; pelvics I, 5, long, completely separated; scales large, 30-34 along side, head scaled; no lateral line.

Brown to purplish, about 7-8 narrow (one scale wide) oblique bars on upper sides; a dark bar under the eye; side of head with several dark brown stripes; a prominent blue "ear" spot behind upper edge of gill cover; dark bar on base of pectoral; second dorsal and anal fins with rows of spots.


Size: grows to at least 61 cm.

Habitat: fresh and brackish waters.



Depth: 2 m.

Southern California to the lower Gulf of California to northern Peru, and the Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Inhabit estuaries, stagnant ditches or creeks of low current velocity between the sea and an elevation of 30 m. Benthic and most abundant on sandy and muddy bottoms. Ingests much mud and detritus, although also filter plankton (Ref. 36880). Found in shallow inshore areas; typically in freshwater but moves freely into the sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Eastern Pacific, and is found from southern California, USA and the Gulf of California, Mexico to Ecuador, including the Galapagos Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Palos Verdes in southern California, USA to Peru.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific slope from California to Peru: Colombia, Costa Rica, Ecuador, El Salvador, Guatemala, Mexico, Nicaragua, Panama, Peru and U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 2 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 61.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 610 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

41.0 cm TL (male/unsexed; (Ref. 5404)); 39 cm TL (female); max. published weight: 1,200 g (Ref. 5404); max. published weight: 1,300.0 g
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body compressed; head flat; first dorsal fin with 7 spines, second with 1 spine and 8 to 9 rays; anal fin with 1 spine and 9 to 10 rays; lateral line with 30 to 34 scales; body depth contained about three times in standard length; body dark green to dark brown with numerous small pale spots (Ref. 55763).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Dormitator latifrons
Catalog Number: USNM 123236
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Xantus
Locality: Baja California: Cape San Lucas, Baja California Sur, Mexico, Pacific
  • Paratype: Ginsburg, I. 1953. Journal of the Washington Academy of Sciences. 43 (1): 20.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Dormitator latifrons
Catalog Number: USNM 7350
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Baja California: Cape St. Lucas, Baja California Sur, Mexico, Pacific
  • Holotype: Ginsburg, I. 1953. Journal of the Washington Academy of Sciences. 43 (1): 20.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Dormitator latifrons
Catalog Number: USNM 8241
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): J. Xantus
Locality: Colima, Mexico, North America
  • Paratype: Ginsburg, I. 1953. Journal of the Washington Academy of Sciences. 43 (1): 20.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This amphidromous fish inhabits estuaries, stagnant ditches or creeks of low current velocity. It is a benthic species and is most abundant on sandy and muddy substrate (Rojas et al. 1994). It ingests mud, detritus and small fishes. This species is found typically in freshwater, but moves freely into the sea and can be regularly found in middle estuaries, mangroves, bar-formed lagoons and upper estuaries along the tropical eastern Pacific coast (Cooke 1992).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; amphidromous (Ref. 51243); freshwater; brackish; marine; pH range: 7.5 - 9.5; depth range 1 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 45 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.1 - 10
  Temperature range (°C): 24.554 - 29.261
  Nitrate (umol/L): 0.162 - 1.614
  Salinity (PPS): 33.475 - 34.642
  Oxygen (ml/l): 4.584 - 4.733
  Phosphate (umol/l): 0.202 - 0.429
  Silicate (umol/l): 2.365 - 3.286

Graphical representation

Depth range (m): 0.1 - 10

Temperature range (°C): 24.554 - 29.261

Nitrate (umol/L): 0.162 - 1.614

Salinity (PPS): 33.475 - 34.642

Oxygen (ml/l): 4.584 - 4.733

Phosphate (umol/l): 0.202 - 0.429

Silicate (umol/l): 2.365 - 3.286
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Brackish, Freshwater, Non Marine

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Mud, Sand & gravel, Estuary, Freshwater

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Benthic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dormitator latifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTTGTATTCGGTGCATGAGCGGGAATAGTAGGCACAGCTTTAAGCCTGCTAATTCGAGCCGAACTAAGTCAACCCGGGGCTCTACTGGGAGACGACCAAATTTATAACGTCATCGTGACAGCTCACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGTGGCTTTGGAAACTGATTAATTCCCCTAATGATCGGGGCCCCAGACATGGCCTTTCCTCGAATGAACAACATGAGCTTCTGACTTCTCCCTCCCTCTTTCCTACTACTACTAGCATCTTCTGGAGTAGAAGCAGGAGCAGGCACAGGATGAACAGTTTACCCCCCTTTAGCAGGAAACCTAGCCCACGCGGGTGCTTCTGTAGATCTTACAATTTTCTCACTCCACCTAGCCGGAGTTTCCTCAATTCTTGGGGCCATTAATTTTATTACAACTATTATTAATATGAAACCTCCAGCAATTTCCCAGTACCAAACCCCTCTATTTGTATGAGCAGTCCTAATTACAGCGGTTCTTCTACTACTATCCCTTCCCGTACTTGCCGCCGGCATTACAATGCTTCTAACAGACCGAAACCTAAATACAACCTTCTTCGACCCAGCAGGGGGAGGAGACCCAATTCTTTACCAACATCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dormitator latifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Van Tassell, J.

Reviewer/s
Carpenter, K., Polidoro, B. & Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
Dormitator latifrons has been assessed as Least Concern. This species is widespread in the Eastern Pacific, and is common throughout its range. There are no known major threats to this species, and no current indication of population decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is very common within its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species distribution falls partially into a number of Marine Protected Areas in the Eastern Pacific region (WDPA 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dormitator latifrons

Dormitator latifrons, the Pacific fat sleeper, is a species of sleeper goby found on the Pacific coast of the Americas from around Palos Verdes, California to Peru where it can be found in stagnant or sluggish fresh or brackish waters or nearby marine waters. Males of this species can reach a length of 41 centimetres (16 in) TL while females grow to 39 centimetres (15 in) TL. Most do not exceed 25 centimetres (9.8 in) TL. A maximum weight of 1.2 kilograms (2.6 lb) has been recorded. This species is important to local commercial fisheries and is actively farmed.[2]

References[edit]

  1. ^ Van Tassell, J. 2010. Dormitator latifrons. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 04 July 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Dormitator latifrons" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!