Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A solitary species that inhabits a variety of reef zones from reef flats to lagoon and seaward reefs to a depth of at least 122 m and is fairly common in areas not subjected to heavy spear fishing. Found under ledges during the day (Ref. 9710). Benthopelagic (Ref. 58302). Largest species of squirrelfish and the highest-bodied Sargocentron (Ref. 37816). Juvenile inhabits shallow protected reefs. A nocturnal species that feeds on crabs, shrimps and small fishes. Spine of preopercle venomous. Largest squirrelfish (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa (Ref. 4201) to the Hawaiian and Ducie islands, north to southern Japan, south to Australia; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West-Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Pitcairn Group, north to southern Japan and Ogasawara Islands, south to Western Australia at 17°30'S, Queensland (Australia), New Cal
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 16; Analspines: 4; Analsoft rays: 9 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 450 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

51.0 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 2,550 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits a variety of reef zones from reef flats to lagoon and seaward reefs to a depth of at least 122 m and is fairly common in areas not subjected to heavy spearfishing. Juveniles inhabit shallow protected reefs. A nocturnal species that feeds on crabs, shrimps and small fishes. Spine of preopercle venomous.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Head and body red, scale edges silvery white; spinous dorsal crimson in color; other fins orange-yellow; vertically oblong crimson spot on preopercle behind eye (Ref. 4201). Five oblique scale rows on cheek; body depth 2.4-2.6 in SL; head length (HL) 2.55-2.85 in SL; lower jaw when closed slightly to moderately projecting; snout length 3.0-3.8 in HL larger than orbit diameter in adults; interorbital width 6.3-8.7 in HL; maxilla extending posteriorly to a vertical at front edge of the orbit; anterior end of nasal bone often with 2 close-set, short spines; medioposterior margin of nasal bone spineless; large nasal fossa spineless on margin; slight ridge of upper edge of suborbital bones weakly serrate; 2 subequal opercular spines; long preopercular spine, usually greater than orbit diameter in specimens at least 20 cm SL; 3rd or 4th dorsal spine longest, 1.7-2.3 in HL; 3rd anal spine 1.7-2.3 in HL (Ref. 27370).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Sargocentron spiniferum
Catalog Number: USNM 53044
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): H. Bowie
Locality: Tahiti, French Polynesia, Society Islands, Pacific
  • Holotype: Jordan, D. S. & Snyder, J. O. 1905. Proceedings of the United States National Museum. 29 (1422): 353, fig. 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Sargocentron spiniferum
Catalog Number: USNM 109394
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Seale
Locality: Society Islands Tahiti, Tahiti, French Polynesia, Society Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 122 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 177 specimens in 1 taxon.
Water temperature and chemistry ranges based on 161 samples.

Environmental ranges
  Depth range (m): 0.4575 - 53.35
  Temperature range (°C): 23.822 - 29.336
  Nitrate (umol/L): 0.043 - 2.714
  Salinity (PPS): 32.495 - 36.148
  Oxygen (ml/l): 4.444 - 4.847
  Phosphate (umol/l): 0.054 - 0.507
  Silicate (umol/l): 0.819 - 15.721

Graphical representation

Depth range (m): 0.4575 - 53.35

Temperature range (°C): 23.822 - 29.336

Nitrate (umol/L): 0.043 - 2.714

Salinity (PPS): 32.495 - 36.148

Oxygen (ml/l): 4.444 - 4.847

Phosphate (umol/l): 0.054 - 0.507

Silicate (umol/l): 0.819 - 15.721
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 122m.
From 1 to 122 meters.

Habitat: reef-associated. Sabre squirrelfish.  (Forsskal, 1775)  Attains 45 cm. Red Sea and east coast of Africa outh to Natal, east to French Polynesia and the Pitcairn Group. This is the largest of the of the squirrelfishes. Preopercular spine is very long and venomous.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits rocky and coral reefs (Ref. 9137, 58534). A solitary species that inhabits a variety of reef zones from reef flats to lagoon and seaward reefs to a depth of at least 122 m and is fairly common in areas not subjected to heavy spear fishing. Found under ledges during the day (Ref. 9710). Largest species of squirrelfish and the highest-bodied Sargocentron (Ref. 37816). Juveniles inhabit shallow protected reefs. A nocturnal species that feeds on crabs, shrimps and small fishes. Spine of preopercle venomous. Largest squirrelfish (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sargocentron spiniferum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sargocentron spiniferum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGTACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCTGGAGCTCTCCTGGGAGACGACCAGATTTATAATGTCATTGTTACAGCCCACGCATTTGTAATAATTTTCTTTATGGTAATGCCAATTATGATTGGAGGCTTTGGGAATTGACTAATCCCCCTAATGATTGGAGCCCCTGACATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTATTACCCCCATCATTCCTTCTTCTACTAGCCTCTTCCGGAGTAGAAGCTGGTGCCGGTACAGGATGAACAGTATACCCACCCCTTGCAGGTAATTTAGCCCACGCAGGGGCTTCTGTTGACCTTACTATTTTCTCACTCCATCTAGCAGGTATTTCTTCAATTCTTGGGGCCATTAATTTTATTACAACTATTATTAACATAAAACCCCCTGCCATTTCCCAATACCAAACTCCCCTATTTGTATGAGCTGTCCTCATCACAGCTGTCCTTCTACTTCTATCCCTACCCGTGCTCGCAGCAGGAATTACCATGCTGCTAACAGACCGAAACCTAAACACAACATTCTTCGACCCAGCAGGAGGTGGAGACCCAATCCTTTACCAACACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sargocentron spiniferum

Sargocentron spiniferum, common name Sabre Squirrelfish, Giant Squirrelfish or Spiny Squirrelfish, is a species of squirrelfish belonging to the family Holocentridae.

Description[edit]

Sargocentron spiniferum is the largest of the squirrelfishes and can reach a length of 45–50 centimetres (18–20 in). The body is oval and laterally compressed. The head has a pointed snout and large eyes, being largely nocturnal. The basic colour is bright red. It has silver scale margins, a spinous dorsal fin and a large deep red patch just behind the eyes. The lower jaw protrudes beyond the upper jaw. It bears a very long preopercle spine (near the gill-opening). The anal and ventral fins are yellowish. The caudal fin is clearly bifid.

Distribution[edit]

This species is widespread throughout the tropical Indo-Pacific, from the Red Sea and Indian Ocean up to Hawaii, Japan and southern Australia.

Habitat[edit]

This squirrelfish can be found in tropical waters on coral reefs, from shallow water to a depth of 120 meters.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!