Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in shallow coastal reef flats, usually found in less than 5 m water depth, but ranges to deep water rubble reefs (Ref. 48635). Benthic (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: South Africa and Oman to the Hawaiian and Society islands, north to the Ryukyu and Ogasawara islands, south to northern Australia and the Loyalty Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Oman, East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Society Islands, and Rapa, north to Ryukyu Islands and Ogasawara Islands, south to Western Australia and Norfolk Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 505 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.5 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Usually found in less than 5 m water depth.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body light brown, with dendritic pattern. Corner of mouth with a dark brown spot, preceded on lower lip by a large white blotch (often followed by another above and behind corner of mouth); upper and lower jaw pores usually in prominent white spots. Vertebrae 121-133.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 45 m (Ref. 11441), usually ? - 5 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 244 specimens in 1 taxon.
Water temperature and chemistry ranges based on 147 samples.

Environmental ranges
  Depth range (m): 0.15 - 69.7
  Temperature range (°C): 22.496 - 29.058
  Nitrate (umol/L): 0.016 - 2.714
  Salinity (PPS): 32.185 - 35.552
  Oxygen (ml/l): 4.202 - 5.079
  Phosphate (umol/l): 0.044 - 0.507
  Silicate (umol/l): 0.506 - 7.618

Graphical representation

Depth range (m): 0.15 - 69.7

Temperature range (°C): 22.496 - 29.058

Nitrate (umol/L): 0.016 - 2.714

Salinity (PPS): 32.185 - 35.552

Oxygen (ml/l): 4.202 - 5.079

Phosphate (umol/l): 0.044 - 0.507

Silicate (umol/l): 0.506 - 7.618
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 45m.
From 1 to 45 meters.

Habitat: reef-associated. Usually found in less than 5 m water depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Gymnothorax chilospilus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Gymnothorax chilospilus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATATTTAGTATTTGGTGCCTGAGCCGGAATGGTCGGCACCGCCTTAAGCCTACTTATTCGAGCTGAGCTAAGCCAGCCCGGGGCTCTCCTAGGTGACGACCAGATTTATAACGTAATCGTAACAGCACATGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGTTTCGGAAATTGACTAATCCCTCTTATGATTGGGGCCCCTGATATGGCATTCCCCCGAATAAATAACATAAGCTTCTGGTTACTGCCCCCATCCTTCCTATTACTTCTCGCCTCCTCTGGGGTAGAAGCAGGGGCTGGCACCGGATGAACTGTCTACCCCCCTCTCGCGGGAAACCTGGCCCACGCTGGAGCATCTGTTGATCTAACTATTTTCTCCCTCCACTTAGCTGGGGTTTCATCAATCCTAGGGGCAATCAACTTTATTACAACCATTATTAACATAAAACCTCCCGCCATCACACAATACCAAACACCTTTATTTGTTTGAGCTGTATTAGTTACCGCAGTTCTTCTTTTACTCTCTCTCCCAGTATTGGCAGCTGGTATTACAATGCTTTTAACTGACCGAAATCTCAATACAACTTTCTTTGACCCCGCTGGAGGAGGTGACCCAATTCTCTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gymnothorax chilospilus

The lipspot moray, textile moray, white-lipped moray, or the white-lipped reef eel,[1] Gymnothorax chilospilus, is a moray eel found in coral reefs in the Pacific and Indian Oceans.[2] It was first named by Pieter Bleeker in 1864.[2]

References[edit]

  1. ^ Common names for Gymnothorax chilospilus at www.fishbase.org.
  2. ^ a b Gymnothorax chilospilus at www.fishbase.org.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!