Overview

Comprehensive Description

Biology

Occurs in warm springs and their effluents, canals and weedy ditches, and stream pools (Ref. 5723). Food is mainly detritus (Ref. 36880). Some populations in caves (Ref. 27297).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Atlantic molly, or cave molly, is a small, freshwater livebearing fish that feeds on invertebrates and, in sunlit environments, algae. Its range extends from northeastern Mexico down through Central America (Tobler et al, 2008). P. mexicana has undergone a divergent shift between sub-populations in terms of environmental preferences: while most of the species resides in tropical streams and stream pools, distinct populations have colonized cave environments and undergone shifts in morphology and behavior (Menzel and Darnell, 1973).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Poecilia mexicana exhibits a large range of sizes that vary based on habitat- the standard length is 24-54 mm for females and slightly smaller for males, around 20-42mm (Menzel and Darnell, 1973). Although many traits vary from population to population, P. mexicana is generally a slender fish with broad caudal and dorsal fins (Plath et al, 2003). Coloration varies, but it is often intricate with beautiful markings on the fins (Tober and Plath, 2010).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

P. mexicana is thought to be the female parent of Poecilia formosa, an all-female poeciliid species known as the Amazon molly (Avise et al, 1991).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to Atlantic slope from Rio San Juan, Mexico, to Guatemala. Established in a drainage canal south of Mecca, Riverside County, California; Bruneau Hot Springs, Owyhee County, Idaho; and in springs and the Moapa River, Clark and Lincoln counties, Nevada; common at some localities (Page and Burr 1991). Widespread and solidly established in Nevada waters (Minckley 1973; Moyle 1976). Established in fresh waters in Hawaii (Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic coast of Central America, from Texas border, through Yucatán into Guatemala and Costa Rica; introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North and Central America: Rio San Juan, Mexico to Guatemala. At least one country reports adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

P. mexicana inhabits aquatic tropical habitats, including streams and ponds, from northern Mexico to the river systems in the southern provinces such as the Rio Jampa system around Veracruz City (Menzel and Darnell, 1973). The species is also present in the Atlantic areas of Central America (Tobler et al, 2008).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

In P. mexicana, morphology varies based on population. Cave populations exhibit different traits than epigean populations, which live in open environments in streams and ponds.

The epigean form is laterally compressed and has a deep body, with a gentle, steady slope descending from the anterior tip of the dorsal fin to the snout (Menzel and Darnell, 1973). The fish can be quite deep in the trunk: females swell when they are carrying young. In males, the anal fin is modified and elongated into a gonopodium, a reproductive structure (Meefe and Snelson, 1989). P. mexicana possesses obvious spots and bands in a pattern along its body. (Parzefall, 2001).

The cave form is much more slender and has smaller fins. It shows a slightly concave curve from the anterior tip of its dorsal fin to its snout. It also exihibits reduced eyes and a much higher incidence of free neuromasts (neuromasts are a sensory structure in fish that occur exposed on the body or in canals). Some canal segments develop without a complete covering and there are several large free neuromasts on the head. It's head is also smaller and it has highly reduced pigmentation, sometimes resulting in a yellow-colored fish (Parzefall, 2001).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 110 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

11.0 cm SL (male/unsexed; (Ref. 30499))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The size ranges based on population: females tend to be larger than males with a standard length of 24-54mm. Males are 20-42mm (Plath et al, 2003).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Poecilia mexicana in many ways resembles other poeciliid species, exhibiting many typical "molly-like" characteristics. P. mexicana can be distinguished in certain instances by its habitat- the cave species is the only poeciliid species in the sulfidic cave environments in which it lives. The cave species exhibits a reduced head size and less obvious lateral compression, in addition to reduced eyes (Tober and Plath, 2010).

In all populations, the anal fin originates directly under the dorsal fin. The epigean forms exhibits bright colors on the caudal and dorsal fins and a distinctive pattern of banded spots that span the entire body in multiple lines from the gill region to the caudal fin (Parzefall, 2001).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Poecilia cuneata Garman
Catalog Number: USNM 120285
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Locality: Turbo, Gulf of Darien, Pan., Darien Province, Panama, North America
  • Syntype: Garman, S. 1895. Memoirs of the Museum of Comparative Zoology at Harvard College. 19 (1): 62, pl. 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Warm springs and their effluents, canals, weedy ditches, and stream pools (Page and Burr 1991). In Nevada, found in warm springs. In California, has been collected in freshwater ditches around Salton Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; non-migratory; freshwater; brackish; pH range: 7.0 - 7.5; dH range: 20 - 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.35 - 1.5

Graphical representation

Depth range (m): 0.35 - 1.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

P. mexicana occurs in either the surface environments of streams and ponds or the dark environment of of subterranean caves. It can be found in stream environments throughout its range, in which adults live with mixed schools in deeper regions and juveniles gravitate toward shallower areas (Parzefall, 2001). It is well known for its colonization of the sulfidic cave and its surroundings in Cueva de Azufre. P. mexicana has been able to adapt to the complete range of hydrogen sulfide levels and darkness found in and around the Cueva de Azufre system (Tobler and Plath, 2010).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Cave forms remain localized in their habitat, and do not display territorial behavior. Surface forms move freely within their habitats, although dominant males and females establish loose territories in which subordinates also live and try to compete for food and mates (Plath et al, 2003)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet varied. Feeds on both plant and animal matter; vascular plants and mosquito larvae are important items in the diet (Brown 1971).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

To compensate for unpredictability of food quality and quantity results also in phyisological adaptations: cave animals are able to survive for long periods without food (Ref. 52994).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

P. mexicana eats an omnivorous diet. In a "typical molly habitat", a clear stream, the primary nutrition sources available are algae and small invertebrates. In cave environments, where food is thought to be plentiful, P. mexicana subsists on chironomid flies and larvae, chemoautotrophic sulfur bacteria, and bat guano. (Plath et al, 2005).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Capillaria Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Has contributed to the decline of native, spring-inhabiting species in Nevada (Minckley 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adult stream-dwelling fish generally live in large, mixed schools in the deeper regions of rivers and streams, while juvenile fish tend to reside in the calmer shallows where they can take cover in plant growth. Within populations of mature fish, hierarchies appear in both sexes: the females compete for food, and males compete for females. To maintain and establish these hierarchies, aggressive behavior occurs in both sexes, including chasing and biting (Parzefall, 2001).

Cave mollies, on the contrary, exhibit reduced aggressiveness in all situations and rarely initiate aggressive behavior. It seems that a lack of light interrupts many of the standard aggressive techniques. Furthermore, the cave populations of P. mexicana do not form schools at all. This suggests the role of visual input in schooling behavior and coordination (Parzefall, 2001).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

28 days after fertilization female gives birth to 30-80 young. Sexual maturity is reached after 7-12 months (Ref. 2060).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Reaches sexual maturity at about 1.5 to 2" in length. Under suitable conditions may produce several broods a year (Brown 1971). Fertilization internal; young born alive.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

P. mexicana is a viviparous fish that undergoes internal fertilization and live birth with unique morphological adaptions. The female has fused ovaries and exhibits superfetation, the condition of supporting offspring that differ in age and resulted from different matings. The male has fused testes that form a tubular organ that transports cyst-like bundles of sperm. These sperm travel down the gonopodium, which is a specialized organ for transferring sperm into the female. This organ is actually a modified anal fin consisting of thickened fin rays and an elongated structure.

During copulation, the gonopodium is positioned at the entrance of a female's oviduct and transfers the bundles of sperm. Females can store sperm in the ovary and gonoduct for up to eight months and have short interbrood intervals (Meefe and Snelson, 1989),

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Poecilia mexicana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 39
Specimens with Barcodes: 110
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Poecilia mexicana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 36 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGCATAGTGGGAACAGCTCTGAGTCTTTTAATCCGAGCCGAACTCAGTCAACCAGGATCCCTCCTAGGCGATGATCAAATTTATAATGTAATCGTCACAGCTCATGCCTTTGTAATAATCTTTTTTATAGTTATGCCAATTATAATTGGCGGCTTCGGTAATTGATTAGTACCACTAATAATTGGTGCCCCTGATATAGCCTTTCCACGAATAAATAATATGAGCTTCTGACTTCTACCGCCCTCATTCCTCCTCCTCCTAGCATCTTCTGGGGTAGAAGCAGGGGCTGGTACAGGTTGAACCGTCTACCCACCTCTTGCAGGCAATTTAGCCCACGCTGGACCCTCTGTAGATCTAACTATTTTTTCACTCCACCTGGCAGGTATTTCCTCCATCCTAGGGGCAATCAACTTTATTACCACTATTATTAATATAAAACCCCCTGCAGCATCTCAATACCAAACACCCCTATTTGTCTGAGCTGTAATGATTACAGCTGTACTTCTGCTTCTCTCCCTTCCTGTACTCGCCGCTGGCATCACCATGCTTCTGACAGATCGAAATCTAAATACCACTTTCTTCGACCCTGCNGGAGGGGGAGATCCAATTCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No special status (IUCN.org)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not listed (IUCN.org)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Poecilia mexicana seems to be growing in number as nonnative populations become established, especially in the United States. The release of aquarium specimens and escapes from fish farms is the likely cause of this ((Poecilia mexicana (shortfin molly") ).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Poecilia mexicana is actually proving to be a threat to Unites States ecosystems as it begins to act as a harmful invasive species. It affects ecosystems by preying on native larval fish and decimating local populations of damselflies ("Poecilia mexicana (shortfin molly") )

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Poecilia mexicana is a very important research subject for investigating the effects of adaptations to extreme environments on a population's morphology and behavior. Many studies have been done to describe these effects, and the existence of cave-dwelling populations (the extremophile form, or the population dwelling in an environment of biological extremes such as low light and high hydrogen sulfide content) and more typical epigean populations allow for comparison between the two forms and a thorough assessment of the evolutionary and behavioral implications of these adaptions (Tober and Plath, 2010)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Included in the POECILIA "SPHENOPS complex" by Lee et al. (1980). Included in order Cyprinodontiformes by Parenti (1981).

See Breden et al. (1999) for a molecular phylogeny of POECILIA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!