Overview

Comprehensive Description

Biology

Anguilliform, has no pectoral and ventral fins; its dorsal and anal fins are vestigial (Ref. 27188). Adults inhabit streams, ponds, canals, drains, rice fields, both clear and turbid water (Ref. 11225). Nocturnal (Ref. 11225). Carnivore (Ref. 26543). The male guards and builds nest or burrow (Ref. 205). A protogynous hermaphrodite (Ref. 55367). Its being a facultative air-breather (Ref. 1468) explains, at least in part, why it is often missing from faunal inventories. At the start of the dry season when there's a decline in water level, it digs a tubular burrow in a bank or on the bottom. This burrow, which is for the most part sub-horizontal , can have several diverticula, followed by a vertical section which leads to the exterior by only one opening. Although breathing is slowed down, the fish remains active and flees if it is disturbed (Ref. 27188).
  • Kullander, S.O. 2003 Family Synbranchidae (Swamp-eels). p. 594-595. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 79717)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Central and South America: Mexico to northern Argentina.
  • Kullander, S.O. 2003 Family Synbranchidae (Swamp-eels). p. 594-595. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 79717)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Widespread in Central and South America; Mexico to northern Argentina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 79717))
  • Kullander, S.O. 2003 Family Synbranchidae (Swamp-eels). p. 594-595. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 79717)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body cylindrical and long; eyes small; dorsal and anal fins vestigial (Ref. 26543).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; potamodromous (Ref. 51243); freshwater; brackish
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 51 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.1 - 15

Graphical representation

Depth range (m): 0.1 - 15
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Pterygifer Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Bunkley-Williams, L. and E.H. Williams Jr. 2002 Nematodes of freshwater fishes of the Neotropical region. (Book review). Caribb. J. Sci. 38(3-4):289-294. (Ref. 46699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eustrongylides Infestation 2 (Larvae). Parasitic infestations (protozoa, worms, etc.)
  • Moravec, F. 1998 Nematodes of freshwater fishes of the neotropical region. 464 p. Praha, Academy of Sciences of the Czech Republic. (Ref. 51153)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

A diandric species having both primary and secondary male developmental pathways. Length at sex change = 34.0 cm TL (Ref. 55367). Also Ref. 35344.
  • Lo Nostro, F.L. and G.A. Guerrero 1996 Presence of primary and secondary males in a population of the protogynous Synbranchus marmoratus. J. Fish Biol. 49:788-800. (Ref. 13454)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Synbranchus marmoratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTCTTCTCTACTAATCACAAAGACATTGGTACCCTTTATTTAGTCTTCGGTGCCTGAGCTGGTATTCTTGGTTCAGGCCTTAGCCTTCTAATCCGGACAGAGCTCTGCCAACCTGGTACTGTTATTGGCGAC---GACCAAATTTATAATGTTATCGTTACAGCACATGCATTTGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGTGGGTTTGGAAACTGACTAGTCCCATTAATAATTGGTTCCCCCGATATAGCTTTTCCACGAATGAACAATATAAGCTTCTGACTTCTTCCCCCATCCTTCCTACTTCTATTAGCATCTGCTGGAGTAGAGGCCGGTGCTGGAACAGGGTGAACCGTTTATCCCCCTCTCGCAGGCAACTTAACCCACGCAGGCGCCTCCGTGGATTTAACAATCTTCTCCTTACACTTAGCAGGGGCTTCCTCAATTCTAGGTGCTATTAACTTCATTACTACAATTATTAACATAAAACACCCCACCGTTACACAATACCAGACCCCTTTATTCGTATGATCAATTATAATTACAGCCGTCCTACTTCTTCTTTCTCTACCAGTCTTAGCAGCAGGTATTACAATACTTTTAACAGATCGAAACCTAAACACAACCTTCTTTGATCCTGCTGGTGGAGGAGACCCCATTCTTTATCAACATTTATTCTGATTTTTTGGACATCCAGAAGTCTACATTCTAATCCTTCCAGGTTTTGGAATAATCTCACATGTCGTTGCCTACTACTCAGGCAAAAAAGAGCCTTTCGGATATATAGGAATAGTATGAGCCATGATAGCAATTGGCCTTCTAGGCTTCATTGTTTGAGCACATCACATATTCACAGTCGGTATAGACGTAGACACACGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Synbranchus marmoratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: public aquariums
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!