Overview

Comprehensive Description

Biology

Anguilliform, has no pectoral and ventral fins; its dorsal and anal fins are vestigial (Ref. 27188). Adults inhabit streams, ponds, canals, drains, rice fields, both clear and turbid water (Ref. 11225). Nocturnal (Ref. 11225). Carnivore (Ref. 26543). The male guards and builds nest or burrow (Ref. 205). A protogynous hermaphrodite (Ref. 55367). Its being a facultative air-breather (Ref. 1468) explains, at least in part, why it is often missing from faunal inventories. At the start of the dry season when there's a decline in water level, it digs a tubular burrow in a bank or on the bottom. This burrow, which is for the most part sub-horizontal , can have several diverticula, followed by a vertical section which leads to the exterior by only one opening. Although breathing is slowed down, the fish remains active and flees if it is disturbed (Ref. 27188).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Central and South America: Mexico to northern Argentina.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Widespread in Central and South America; Mexico to northern Argentina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 79717))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body cylindrical and long; eyes small; dorsal and anal fins vestigial (Ref. 26543).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; potamodromous (Ref. 51243); freshwater; brackish
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 51 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.1 - 15

Graphical representation

Depth range (m): 0.1 - 15
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Pterygifer Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eustrongylides Infestation 2 (Larvae). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

A diandric species having both primary and secondary male developmental pathways. Length at sex change = 34.0 cm TL (Ref. 55367). Also Ref. 35344.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Synbranchus marmoratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Synbranchus marmoratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTCTTCTCTACTAATCACAAAGACATTGGTACCCTTTATTTAGTCTTCGGTGCCTGAGCTGGTATTCTTGGTTCAGGCCTTAGCCTTCTAATCCGGACAGAGCTCTGCCAACCTGGTACTGTTATTGGCGAC---GACCAAATTTATAATGTTATCGTTACAGCACATGCATTTGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGTGGGTTTGGAAACTGACTAGTCCCATTAATAATTGGTTCCCCCGATATAGCTTTTCCACGAATGAACAATATAAGCTTCTGACTTCTTCCCCCATCCTTCCTACTTCTATTAGCATCTGCTGGAGTAGAGGCCGGTGCTGGAACAGGGTGAACCGTTTATCCCCCTCTCGCAGGCAACTTAACCCACGCAGGCGCCTCCGTGGATTTAACAATCTTCTCCTTACACTTAGCAGGGGCTTCCTCAATTCTAGGTGCTATTAACTTCATTACTACAATTATTAACATAAAACACCCCACCGTTACACAATACCAGACCCCTTTATTCGTATGATCAATTATAATTACAGCCGTCCTACTTCTTCTTTCTCTACCAGTCTTAGCAGCAGGTATTACAATACTTTTAACAGATCGAAACCTAAACACAACCTTCTTTGATCCTGCTGGTGGAGGAGACCCCATTCTTTATCAACATTTATTCTGATTTTTTGGACATCCAGAAGTCTACATTCTAATCCTTCCAGGTTTTGGAATAATCTCACATGTCGTTGCCTACTACTCAGGCAAAAAAGAGCCTTTCGGATATATAGGAATAGTATGAGCCATGATAGCAATTGGCCTTCTAGGCTTCATTGTTTGAGCACATCACATATTCACAGTCGGTATAGACGTAGACACACGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!