Overview

Comprehensive Description

Biology

Often found in caves or under ledges. Swim with belly toward substratum, thus under ledges seen upside down. Feed on ectoparasites of other fishes (Ref. 5521). Males show various types of nest care behavior (Ref. 35580). Retreat into recesses when alarmed (Ref. 9710). Have been reared in captivity (Ref. 35420).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Central Atlantic: Bermuda, Bahamas, and Central America to northern South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 80 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Bicolored: purple (appearing blue underwater) in front, bight orange-yellow behind (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 60 m (Ref. 9710), usually 1 - 40 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 30 samples.

Environmental ranges
  Depth range (m): 1 - 43
  Temperature range (°C): 26.706 - 27.684
  Nitrate (umol/L): 0.161 - 1.844
  Salinity (PPS): 34.880 - 36.594
  Oxygen (ml/l): 4.543 - 4.687
  Phosphate (umol/l): 0.046 - 0.176
  Silicate (umol/l): 1.868 - 2.664

Graphical representation

Depth range (m): 1 - 43

Temperature range (°C): 26.706 - 27.684

Nitrate (umol/L): 0.161 - 1.844

Salinity (PPS): 34.880 - 36.594

Oxygen (ml/l): 4.543 - 4.687

Phosphate (umol/l): 0.046 - 0.176

Silicate (umol/l): 1.868 - 2.664
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 60m.
From 1 to 60 meters.

Habitat: reef-associated. Inhabits caves or under ledges. Swims with belly toward substratum, thus under ledges seen upside down. Feeds on ectoparasites of other fishes (Ref. 5521). Males brood eggs in the mouth. Retreats into recesses when alarmed (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Often found in caves or under ledges. Feeds on benthic and planktonic crustaceans (Ref. 26355). Mobile invertebrates feeder (Ref. 57616). Swim with belly toward substratum, thus under ledges seen upside down. Males show various types of nest care behavior (Ref. 35580). Retreat into recesses when alarmed (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mouthbrooding in this specimen has not been supported by any evidence (Ref. 35580).Prior to spawning, some males established nest sites, using small holes and crevices in the substratum. Females traveled to male nests for egg deposition around dawn. Eggs deposited within the nests were tended by males that established the nests. Males display four types of nest care behaviour: guarding, nest maintenance, detritus clearing,and simple nest entering (Ref. 35580).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproductive strategies

Adult G. loreto males establish nest sites, using small holes and crevices in the substratum, as a preparatory act leading to spawning, Males also utilise algae that they cut from the substrate to line the nests and to conceal the nest opening. Females subsequently travel to these nests prepared by the males, for egg deposition, typically in early morning at first appearance of sunlight. Females deposit eggs, that are negatively bouyant and about one millimeter in size to form a multilayer egg mass. Males guard and care for the eggs with four types of nest care behaviour: nest guarding, nest maintenance, detritus clearing in the nest vicinity, and periodic nest entering. The eggs hatch after ten or eleven days, and then the larvae are believed to enter the planktonic stage until they are sufficiently heavy to resettle by gravity onto the reef.

  • Mark Mcginley. 2011. Fairy basslet. Eds. C.Michael Hogan & Cutler J.Cleveland. Encyclopedia of Earth. National Council for Science and the Environment. Washington DC http://www.eoearth.org/article/Fairy_basslet?topic=49540
  • K.Asoh and D.Shapiro 1997 Bisexual juvenile gonad and gonochorism in the fairy basslet, Gramma loreto. Copeia (1):22-31
  • P.Humann and N.Deloach (Eds.) 1994. Reef Fish Identification: Florida, Caribbean, Bahamas. New World Publications, Inc. Jacksonville, FL. ISBN: 1878348078
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Gramma loreto

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 32
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Gramma loreto

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTATTATTTGGTGCTTGAGCCGGTATAGTAGGAACTGCCCTAAGCCTACTAATCCGAGCAGAACTAAATCAACCCGGCTCCCTCCTAGGGGATGACCAGATTTACAATGTTATCGTTACAGCACACGCCTTTGTAATGATCTTTTTTATAGTTATGCCAATCATAATTGGAGGGTTCGGAAACTGATTAATCCCTCTCATAATTGGGGCTCCTGACATAGCCTTCCCCCGAATAAATAATATGAGCTTTTGACTCCTCCCCCCATCCTTCATCCTTTTACTTGCCTCTTCCGCAGTCGAAGCTGGTGCCGGCACAGGGTGGACTGTTTACCCCCCTTTATCTAGCAATCTAGCCCACGCCGGAGCATCCGTTGACCTCACAATTTTTTCCCTGCATTTAGCAGGTATCTCCTCTATCCTGGGGGCTATTAACTTCATCACTACTATCATTAACATGAAACCCCCGGCTATTACCCAATATCAAACACCCCTTTTCGTTTGAGCCGTCCTAATTACAGCCGTGCTCCTTCTCCTATCCCTACCCGTTCTTGCCGCAGGCATTACAATACTCCTAACTGATCGAAATCTAAATACCTCCTTCTTTGACCCGGCGGGAGGGGGGGACCCGATTCTCTACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Royal gramma

Gramma loreto, the Royal gramma, also known as the fairy basslet, is a species of basslet native to reef environments of the tropical western Atlantic Ocean. They are also found in the aquarium trade.[1]

Appearance[edit]

The fish can be a light purple to a deep violet starting at the head which fades mid-body to a golden yellow at the tail. The Royal Gramma will also have a small black spot on the front of the dorsal fin and a black line that streaks through the eye. It resembles the false gramma (Pictichromis paccagnellae), with the two main differences between the two being the false gramma has clear fins and does not fade, but rather has a distinct change in color. The royal gramma is relatively small, averaging slightly over 8 cm (3 inches) and has been tank bred. The largest royal gramma was measured at 8 cm (3.1 in).

Diet[edit]

The royal gramma is a planktivore, eating mostly zooplankton and crustaceans. It will also accept frozen and meaty foods, such as brine shrimp and mysid shrimp in the wild. The royal gramma is very easy to feed; but rotating their foods is said to keep them from becoming picky. In the wild, the royal gramma is a cleaner fish. It removes the ectoparasites (a parasite that lives on the skin of a fish) from other fish and learns to eat dead food, such as crustaceans and fish flesh. Captive royal gramma will also eat flake and pellet foods. They prefer to pick their food from the middle of the water column.

Range[edit]

Their natural range covers the Bahamas, Venezuela, Lesser Antilles, Bermuda, and through the waters surrounding Central America and the northern part of South America. The Royal Gramma tends to swim more towards the bottom with the depth range between 1 and 20 m (3 and 60 ft).

In the aquarium[edit]

Royal gramma in the Musée océanographique of Monaco

Due to their relatively peaceful nature, diet, and small size, the royal gramma is considered an ideal inhabitant for most reef aquaria containing coral and other invertebrates. Notwithstanding this general statement, they can become aggressive towards tank-mates when kept in smaller nano reef tanks. They stake out territories throughout rocks and crevices and choose favorite hiding places. They are generally peaceful fish, but are very protective of their territories and are known for chasing out other small fish. They tend to stay in one area of the tank and, when startled, will dart back into their holes. They will vigorously guard their hiding places and, when threatened, will open their mouths wide in a threatening gesture to ward off the intruders. The royal gramma tends to orient itself to be parallel with the surface to which it is closest, resulting in the fish swimming straight up and down or sometimes upside down beneath ledges. This behavior is not to be mistaken for illness. The minimum suggested tank size is 30 gallons and the tank should not receive sharp lighting. The ideal water temperature should range between 72 and 78°F and the water pH should be between 8.1 and 8.4, with specific gravity of 1.020-1.025. [2] They are often kept in reef aquaria and are generally kept singly or in pairs. However, small groups can be kept as long as the tank is large enough and has enough cracks and crevices for each fish to have its own territory. The royal gramma should not be kept with its own kind unless in a formed male-female pair. It should also not be kept with larger, aggressive fish that will eat them. They are, however, resistant to most diseases and make very good beginner fish.

Breeding[edit]

Although pairs are difficult to find because the difference between male and female is not visible, they are very easy to breed. With males usually being larger than females, the male will build the nest among rocks using pieces of algae.[3] The male will then lead the female to the nest, where she will deposit 20-100 eggs in the nest. During the breeding period, this behavior is repeated almost every day for a month or longer. The eggs are about 1 mm (0.04 in) and are equipped with small protuberances over the surface with tiny threads extending from them. These threads hold onto the algae of the nest and keep the eggs in place. The eggs will hatch in five to seven days, normally in the evening, and can feed on rotifers until they are large enough to consume newly hatched brine shrimp.[4]

Compatible fish[edit]

Because the royal gramma is generally a peaceful fish, it gets along with many other types of fish.

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Gramma loreto" in FishBase. August 2013 version.
  2. ^ "Saltwater Aquarium Guide". Retrieved 11 October 2012. 
  3. ^ "thefishchannel.com". Retrieved 11 October 2012. 
  4. ^ "Aquatic Community". Retrieved 11 October 2012. 

Trivia[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!