Overview

Comprehensive Description

Biology

Maximum TL was recorded at 50 cm. Prefers flowing water over rocky bottoms (Ref. 7094). Feeds on vegetation and periphyton (Ref. 28714).
  • Gosse, J.-P. and E.J. Coenen 1990 Distichodontidae. p. 237-260. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and O.R.S.T.O.M., Paris, 384 p. (Ref. 2936)   http://www.fishbase.org/references/FBRefSummary.php?id=2936&speccode=5254 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Africa: Niger (downstream of Bamako), Volta, Ogun, Cross, Chad basin, Wouri and Nile. Also known from Senegal (Ref. 7094).
  • Gosse, J.-P. and E.J. Coenen 1990 Distichodontidae. p. 237-260. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and O.R.S.T.O.M., Paris, 384 p. (Ref. 2936)   http://www.fishbase.org/references/FBRefSummary.php?id=2936&speccode=5254 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is patchily distributed from Guinea to Ethiopia.

Central Africa:In Lower Guinea, Distichodus engycephalus occurs in the Cross River basin, Cameroon.

Northern Africa: This species used to be caught from the Nile at Cairo, but is now Regionally Extinct.

Northeast Africa: It is found in the Jebel system, White Nile, Sudan, as well as Baro River, Ethiopia.

Western Africa: It is known from the Niger, Volta, Ogun, Cross and Chad basins, also known from Sénégal (Daget and Gosse 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 22 - 27; Analsoft rays: 13 - 16
  • Gosse, J.-P. and E.J. Coenen 1990 Distichodontidae. p. 237-260. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and O.R.S.T.O.M., Paris, 384 p. (Ref. 2936)   http://www.fishbase.org/references/FBRefSummary.php?id=2936&speccode=5254 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 2936)); max. published weight: 1,500 g (Ref. 3799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body depth 2.6-3.4x, head length 4-5.4x SL. Caudal peduncle length
  • Gosse, J.-P. and E.J. Coenen 1990 Distichodontidae. p. 237-260. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and O.R.S.T.O.M., Paris, 384 p. (Ref. 2936)   http://www.fishbase.org/references/FBRefSummary.php?id=2936&speccode=5254 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Distichodus engycephalus is a demersal species which prefers flowing water over rocky bottoms. Distichodus engycephalusfeeds on diatoms, filamentous algae, insects and plant material.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Prefers flowing water over rocky bottoms. Feeds on vegetation and peripython.
  • Gosse, J.-P. and E.J. Coenen 1990 Distichodontidae. p. 237-260. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren and O.R.S.T.O.M., Paris, 384 p. (Ref. 2936)   http://www.fishbase.org/references/FBRefSummary.php?id=2936&speccode=5254 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Distichodus engycephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATATCGTATTCGGTGCTTGAGCCGGAATAGTTGGAACCGCTTTGAGCCTTTTAATCCGAGCGGAACTTGGCCAACCCGGATCCTTATTAGAAGACGACCAAATCTACAATGTACTTGTCACTGCACACGCTTTTGTGATAATCTTCTTTATAGTAATGCCAATTATGATCGGAGGATTTGGAAACTGACTAATTCCCCTAATAATTGGTGCCCCAGACATAGCATTCCCTCGAATAAATAATATAAGCTTCTGACTTTTACCACCTTCCTTTCTCCTCCTGCTAGCCTCTTCAGGGGTTGAACAAGGAGCAGGGACAGGCTGAACCGTGTATCCCCCTCTTGCAGGAAATCTAGCTCACGCAGGTGCATCCGTAGATTTAACAATTTTCTCCCTACACCTAGCAGGGGTGTCCTCAATTTTAGGTGCAATCAACTTCATCACAACAATTATTAATATAAAACCGCCCGCAATTTCTCAATACCAAACACCATTATTTGTTTGAGCCGTTTTAGTAACGGCCGTACTTCTACTCCTATCCCTACCTGTCCTTGCTGCAGGAATTACAATGCTTTTAACAGATCGAAATTTAAACACCACATTCTTTGATCCCGCAGGAGGAGGAGACCCAATCCTCTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Distichodus engycephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Azeroual, A., Entsua-Mensah, M., Getahun, A., Lalèyè, P. & Moelants, T.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for north eastern and western Africa. The species used to be found in the lower Nile and was caught at Cairo. It is now Regionally Extinct in north Africa, most likely due to the construction of the Aswan High Dam (completed 1970) which has changed the flow regime of the Nile. There is no immigration from outside the region. It is estimated that less than 5 % of the species is found in the central Africa region and it is therefore categorised as Not Applicable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
In certain regions, overfishing, drought, dam construction and aquatic weeds have a large impact on the species. In Ghana this is a commercially harvested food fish, and thus overfishing is a potential threat. Deforestation and bad agricultural practices may pose potential threats to the habitats of this species. Increasing farming activities in these northern basins may also result in increasing levels of pesticides and other agrochemicals that leach into the water bodies and pose threats to the health of the fish. These two threats are especially relevant in the Black Volta. Another threat is pollution of the water bodies from inadequately treated human waste, for in many of these areas, water bodies are ultimately the receptacles for domestic waste. In the Oti, one major threat is aquatic weeds, which alter the habitat of the fish and may affect all sorts of things such as oxygen levels. In extreme cases, excessive proliferation of aquatic weeds may lead to massive fish kills. In the White Volta, effluents from mining activities may also pose a threat to this fish species. Increasing farming activities may also result in increasing levels of pesticides and other agrochemicals that leach into the water bodies and pose threats to the health of the fish. Another major threat is pollution of the water bodies by inadequately treated human waste and by domestic discharges arising from increasing residential developments (Entsua-Mensah 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known. Policy-based actions are required for this species, along with population trend monitoring and habitat maintenance.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!